gene PH01000564G0170
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01000564:131465 - 135542(+ stand)   Name
Alternate name Locus tag PH01000564G0170
Length of gene 4078  bp Length of CDS 1353  bp
Product information
Feature type
CDS
Product name
CorA-like magnesium transporter protein
Alternate name
Molecular weight
(predicted)
49766.6759200001  kDa
Isoeletric point
(predicted)
5.19053268432617
Length
450  aa
Expression profiles
Expression status (Yes/No)
No
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
SNP ID Position Base in Scaffold Polymorphism
PH01SNP03312240 PH01000564:131668 C C_G
PH01SNP03312250 PH01000564:131679 A A_T
PH01SNP03312260 PH01000564:131715 C C_T
PH01SNP03312270 PH01000564:131886 A A_G
PH01SNP03312280 PH01000564:132413 A A_T
PH01SNP03312290 PH01000564:132660 T T_A
PH01SNP03312300 PH01000564:132898 G G_A
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_156499 5
Please click OG5_156499 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
(0 result)
Gene ID Short description Curator summary Computational description E-value
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os01g68040.1 CorA-like magnesium transporter protein, putative, expressed 5E-86
 
Function (determined by interpro in EMBL-EBI)
Protein family membership
Domains and repeats
None predicted.
Detailed signature matches
    1. PTHR13890 (RNA SPLI...)
Unintegrated signatures no IPR
Unintegrated signatures
  1. PTHR13890:SF0 (SUBF...)
GO term prediction

Biological Process

GO:0015693 magnesium ion transport

Molecular Function

GO:0015095 magnesium ion transmembrane transporter activity

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
specific 213357 229 445 1.47E-42 cd12823 Mrs2_Mfm1p-like cl00459 N
superfamily 241877 229 445 1.47E-42 cl00459 MIT_CorA-like superfamily - N
non-specific 213357 41 134 6.62E-09 cd12823 Mrs2_Mfm1p-like cl00459 C
superfamily 241877 41 134 6.62E-09 cl00459 MIT_CorA-like superfamily - C
Conserved sites/feature
Type Brief name Coordinates Complete size Mapped size Source domain
specific oligomer interface Y229,L232,L244,E245,I247,R248,K251,S252,V255,D256,V258,G259,K263,R265,D266,E269,H270,E273,G274,M340,L341,E343,A344,V347,Q348,E350,G351,N354,R355,S357,I358,R360,E361,Y362,D365,T366,E367,D368,Y369,V370,N371,I372,L374,D375,D376,K377,Q378,N379,Q380,L381,L382,Q383,F384,G385,V386,L388,T389,T390,T392,M393,I394,V395,T396,V397,V399,I400,T401,A402,S406,I407,N408,I409,F421,W422,L425,G426,W442,R445 95 78 213357
specific Cl binding site R265,D266,E269,F346 17 4 213357
generic oligomer interface R69,R72,V73,T83,L85,P119,R123 95 7 213357
 
DNA sequence
Upstream 1000 bp region from PH01000564G0170 gene.
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGGGCGATGGAGAGACGGGCCACGTCGTCCGCGGGCTTTGTCGCCGCAGGATTCGCGCGAGGCGCCGCACGCTGCGTCCGATCGCCTCGCCAGCTCGCTTCCACGGGTGCCTGCTTGGCCACCCGATTCCGCGCTGCGCTGCCTCGTTCGCCCGATCGGCCGCTGTCGCTCCTCGCCACGCGGGTCCTCTACGCACGCAGCCACGCGCGCTAGGCTCGCTCCTTGCCACGCGGTCCCTCTATGCGCGTACGCGTATGCACGCCAGTCTCTAGTATATGTAAGAGGAGTTTTAGTCCACATTTTAGAAGAAAAAAAGGACGCGCTTGAATCTAAGTTTTTATACAAGTCAATTTCGGGGTCAATATATCATGGACACAGGAGTCCGAAACAACAAAGGGAATTATAATTAATTTCGAAATTAAAATTAATCACAATAACATTATTCTGTAGATAGAAATTATATTTGGAATTTATATTAATGGGGAGAATTACAATAAAATTCGGAATATATTAAT
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGTGGTCGCCGCGGTCCCCGCGCTCGCCGCTGCTGCCTCCTCCTCGTGCTGCTGCTGCGCCGGCGACGCCGCTCGGCGGCGGGCGGAGGAAGCCGGGGTCGGCGCCAGCCGCGACGGAGTGGGCAGTCGTGACGGCCAACGGCGCTGTCTGGCGCGAGGAGGCCGGGAGGCACGTCGTTATGCGCCGGACCGGGCTCCCCGCGCGGGACCTTCGGGTCCTCGACCCCGCGCTGTCCCACCCGTCCACTGTCCTCGCGCGGGAGCGCGCCGTCGTGGTCAGCCTCGAGCGCGTCAGGGCCGTCGTCACTGCGTCCGAGGTGCTCGTGCCGTGCTCCAACGAGCACGACGTCCAGCCGCTCGTCCGGAGGCTGGCGTCCTGGGTCTCCGCCTCCGGCCGCCCCGCGTGGCGTAAGCAGGCACAGGAAGCAGAAGGCAACGACGAGAAATCACCGGTATTCGGCACCACGAGCAAGAGGCAGCAGCTGTGTGGGAATGATGGTTATTCTCCGAAGGTTGTCTACACCTTGGAGGAACTGCTGTCCGGTGACGAGGACATCCAAGATGATCCCCCCCGTGTCGCACTCGCACAGGCCGATGAGCCACCGGTGGCACGCGGTGGCGGCGCGAAGATCTTGCCCTTCGAGTTCATAGCACTGGAGGCTATTGCACTGGAGAAAGAGGCATACCCAGCTTTGGATCAATTGACATCGAAAGTGAGCACGCTCAACCTCGAACGGATCAGGCAGATCAAGAGCCGTTTCGTCGACCTCGTAGGTCGTGTTCAGAAGGTAAGGGATGAGCTGGAACATTTGCTAGAAGGCGACCAGGATTTGGCTGCAATGCACTTGTCAGAAAAGGAGGCCTACAGAGAGGCTTTCGATGGGGTCTCGTCAAGATTTGACGTAGAGAAAGTTGTATCAGATTTGGATGAAGAAATGGATCAACACGCTGAAGAAATGCCTGAAGACACCGAAAAAACTTCAGCTGGATTTAGGCCCAACACCCAGGAGCTGGAGATGCTGCTAGAGGCTTACTTTGTGCAGATCGAGGGCACCTTGAACAGGCTCTCCATTCTAAGGGAGTACATCAACGACACGGAGGACTACGTCAACATCATGCTCGACGACAAGCAGAACCAGCTGCTGCAGTTTGGGGTGGTGCTCACCACCGCCACCATGATCGTGACCGTCACCGTCATAACCGCCGGCTTCTTGAGCATCAACATCCGCATCCCTCTGTATCGCACCACGGCCGTGCAGTTCTGGGAAGCTCTCGGCGGTATGGTGATCTCCGGGATCGGCCTGGCCGTGGCCTCCTACGTGTGGTTCAAGCGGAGCGGCTTTCTGCGATGA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01000564G0170 gene.
AAAAACTAGCCGGTTGCAGAACAAGGTTTGTACCAGCAAGCAACATCCATACCCGGAATCTCGTTTGTTCCACTGGCACAGTTGAGAAAATGATGAAAAACCAAAGATTTCACAGAACCGGACGGGTTCGTTTCAAGCCGCCCATGTGGCAACGTCCCACTGTATCAGACTATCAGATTCAGAGAGCACACGTTGTTTATTGTCCCCATCAGTGCAGCCTTCTTGTAACAAAGCTGCCGCCTTCGAACGAGCGAAACAAGAAACAAAAAAGCGTCAGGTTCGAAACACCAGCAGGATGAGACAAACTCCTCAGAAAAAACGGTCCAAATCTCTGGGACTGGGTATCTTTAGCATCACATCTCATTGAATCTCAGTTTCTTGATTATATCTGACCATGTGGTGGAGCTAGTATTTTGATAATAGAGTACCAACTTAAGTGACACATCCATTCTAACATAAATGTTCAAATGACATAGCATGAAAGCTCAAATGAAACAAATTATATGTTTGTACTACAGCCATCATCACAAAAAATATTTTAAAAAACTTACAACTTGACAAGACAATCGTTTATGCTTTGAAAGCGATTGATTACAACAACGTCACTAACTTGTAGAAAAAAATCATGCTCAATGAATGTAACCAAGCAATCATTCAAATATTGATCATTCATGCTATTTCTTAGCTTGTTCTTTACATCGTTTATTGCAGAAAATACTTTCTCTACACTTGCAGTTAGCCACAGCAAGGATCAACAAAGCATAGCTTGTGTATTACATGTACTCCCTCCGGTCACAAAAGAATATCGCTTTGGACATCGACACGGTCTCCAAAATACAACTTTGATCGCTAATTTCTATTGCAATGGATTTATAAAACATAACAAAATTAATTTTTTTTATAAAAGTTCTTTTCGAGACAAATATATACATACCATTTTCATTGTTAAATCTAAATATTGAAAAAGATATCGATAACCAAAGTTTATAAAGTCGGACTAC
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01000564 Download
Protein sequence
Protein sequence
MWSPRSPRSPLLPPPRAAAAPATPLGGGRRKPGSAPAATEWAVVTANGAVWREEAGRHVVMRRTGLPARDLRVLDPALSHPSTVLARERAVVVSLERVRAVVTASEVLVPCSNEHDVQPLVRRLASWVSASGRPAWRKQAQEAEGNDEKSPVFGTTSKRQQLCGNDGYSPKVVYTLEELLSGDEDIQDDPPRVALAQADEPPVARGGGAKILPFEFIALEAIALEKEAYPALDQLTSKVSTLNLERIRQIKSRFVDLVGRVQKVRDELEHLLEGDQDLAAMHLSEKEAYREAFDGVSSRFDVEKVVSDLDEEMDQHAEEMPEDTEKTSAGFRPNTQELEMLLEAYFVQIEGTLNRLSILREYINDTEDYVNIMLDDKQNQLLQFGVVLTTATMIVTVTVITAGFLSINIRIPLYRTTAVQFWEALGGMVISGIGLAVASYVWFKRSGFLR
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above