gene PH01000483G1000
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01000483:643176 - 648917(- stand)   Name
Alternate name Locus tag PH01000483G1000
Length of gene 5742  bp Length of CDS 876  bp
Product information
Feature type
CDS
Product name
no apical meristem protein
Alternate name
Molecular weight
(predicted)
32897.3828199999  kDa
Isoeletric point
(predicted)
6.95730209350585
Length
292  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
SNP ID Position Base in Scaffold Polymorphism
PH01SNP02891070 PH01000483:646408 G G_A
PH01SNP02891080 PH01000483:646952 T T_C
PH01SNP02891090 PH01000483:646967 G G_A
PH01SNP02891100 PH01000483:647378 C C_T
PH01SNP02891110 PH01000483:647491 T T_C
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_164225 5
Please click OG5_164225 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
Gene ID Short description Curator summary Computational description E-value
AT1G56010.2
NAC domain containing protein 1
Encodes a transcription factor involved in shoot apical meristem formation and auxin-mediated lateral root formation. The gene is thought not to be involved in stress responses (NaCl, auxins, ethylene). NAC1 (NAC1)
NAC domain containing protein 1 (NAC1); CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (InterPro:IPR003441); BEST Arabidopsis thaliana protein match is: NAC (No Apical Meristem) domain transcriptional regulator superfamily protein (TAIR:AT3G
2E-82
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os06g46270.1 no apical meristem protein, putative, expressed 2E-166
 
Function (determined by interpro in EMBL-EBI)
Protein family membership

None predicted.

Domains and repeats
  1. Domain
1 50 100 150 200 250 292
Detailed signature matches
    1. SSF101941 (NAC domain)
    2. PS51005 (NAC)
    3. PF02365 (NAM)
Unintegrated signatures no IPR
Unintegrated signatures
  1. PTHR31427 (FAMILY N...)
GO term prediction

Biological Process

GO:0006355 regulation of transcription, DNA-dependent

Molecular Function

GO:0003677 DNA binding

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
specific 216997 11 143 4.68E-68 pfam02365 NAM cl03558 -
superfamily 216997 11 143 4.68E-68 cl03558 NAM superfamily - -
Conserved sites/feature
(0 result)
Type Brief name Coordinates Complete size Mapped size Source domain
 
DNA sequence
Upstream 1000 bp region from PH01000483G1000 gene.
ACTATTTATTTATACGAATTTCACAAAAAGTACACCCTTGGAATTTTTCATGCACAATGATTAATTAGGTAGTGGTATCTTGCATGCATATGAAAATAGTGGTAGTATCATGAACTTGGATTAGGGAATGAAAAATATTGCTAGTTAATATTAGTTGGTAGGCTAGCTTGTGTACTTGCAGTGTTATTATTTGAGCACATGTTGGTGTTTGGCATTATTTAGGTGGTTTTCAGGAAGTAATCTCAGTCTACTAATTTGTTTTTAATTAGTTAGTTAGTTAGCAGTAAACAGCTATCTATCTAAGTTCAAGGGGGTATGTGAGCACATACGTGTGAACTTAAATCCCTTTCGCGGGATATATGAAAGAATCACCGGTTATGACTTTGTCTTTCTTTTTGTCCACTTGGGAGCATTTTTCTGTTGCATGTATCCGATAAATATTTAATTCTAAGGTATGAGGGAGACAAATGAAAAGGATATATCATTATATATGGATTAATGGTTTGATTTTTCATACCAACTTTTACTGACTAATTCCTTGGCTAATACTAGTTTACAGGCCGTCTGCAAATTCAGGTTAAGAGGGCGCAGTGGATAACTACAAGCTGAAGCAACTTAAGGGGCTGATCTGAACTGTCTGCCCGTGATTGTAATAAGTCAAAAGAAGAACTCCAGTTCATTTAAATTTATAATATTTTGCACCAAACCTCAAGAAAGATAAACTAACGGACAACATATATAACCTCCTTTAGAAGGAATAAAGTTGGACATAAGAGTATGTAGACCAATATAATCAGTATACATAAACTTACTTGTCTAGAGCAAACTATAATAGAAAAATAGAGTGGAAGGATCACAAAGAAGATCACGTTTCTATTAGTATATATATAGTTCTAGTATCACGCACTAGTTTTTTCCCCATCTTATCCATAGTACACACACAATGTATTTACATCATTCATGACATATATCTTTCTCTTTTGACCACCCCTTTTCTTTTT
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGAATTCCCTGAGCATGGTGGAGGCGAGGTTGCCCCCGGGGTTCAAATTCCATCCCCGAGACGACGAGCTCGTGCTCGACTACCTGTCCAAGAAGCTCGGCGGCGATGGCGGGGCAGTGGTGAGCATCTACGGCTGCCCGACGATGGTCGACGTCGATCTCAACAAGTGCGAGCCCTGGGACCTTCCTGAAATTGCATGCATTGGTGGCAAAGAGTGGTACTTCTACAGTCTTAGGGACAGGAAGTACGCCACCGGCCAGCGAACAAATAGAGCAACAGAATCAGGTTACTGGAAGGCCACCGGGAAAGATCGTCCAATAAGCCGGAAAGGGTTGCTAGTCGGTATGCGAAAAACCCTTGTGTTTTATCAAGGTAGAGCCCCTAAGGGGAACAAGACTGAGTGGGCCATGCACGAATTTCGCAAGGAAGGGCAAGGTGATCCGATGAAGTTGCCATTCAAGGAGGACTGGGTCTTGTGTAGGGTTTTCTACAAGAGTAGGGCAACAATTGCGAAGTCACCCACAGAGAGTAGCTACTATATTGATAGTGCAGCCGCAAGTTCACTGCCTCCCCTCATTGACAACTACATTGCCTTTGACCAGCATGGAGCAGTGCAAAACCTAGAGGGTTATGCGCAAGTGCCCTGCTTCTCCAATAATCCCTCTCAGCCATCATCGTCGATGAACCTTCCATTGACGTCGCCCATGGTTGATCCGGAGCAACACATGGGGAAGTCGATCAAGGATGTCCTGAGCCAATTCACCATGTTTGAAGGCAACATGAAGAGGCAAGCGTCTCAAAGTAATTTTGCTCATCAGGATGGATTTGAGTACTTAGCTGAGAGTGGCTTCTCACAGATGTGGAACGAACTCAGT
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01000483G1000 gene.
GAGAGAGAGAGAGAGAGAGATGGGAAAGGTTTGTAGGCCGGAGTATCTAGCTAGGCATAGTACAAGGCTAGAGACTTTTCTTGGTTTGAGTGGCAGATGCCAGGTGGCACGCTTTAATTTGTTAAGCCCTGGGCTCAGTTGCTGATCATGTCATGCTCATTCGTTTCCCTTTCCCTCGCTGATGTACGCATGCAGATGCAGCAACGAGCATTCAAAACACCGACATAATCACCGAACATCAGATCGATTAATATCTCAGCTTTGCTTGCTTCGCCTAATTCGAATTCGCAACTCGAAAGATCGCTGGCATGGGCTGTTGGGCACATATGCCTTTTGATGGTTGCATAAGGATAACTGCTACGCGGACAAATACTCATGTACTACAAACTATGTATGATTCATGGACCACCACCGAGGGCTAAGCGGTCACGGTGCCACATAAGTTAGTATCTCGTTTGCAACGCGGGAATTTCATTGAAAACAAGATGTGCGGCTTCCTTTCTAACGAAATTAATTCCTATGGAATTCCCATGTTCCAAAAGCGGCGTAATGGAGTACTGTTGCACGTAGGTGATGGTTCGGCCTAACAGTTTTTATGCGCCTTTAATACGAAATTTCGTACGCATAGCAATTTTCATTACATCTAGTTATACTTAGCAAATAACAATAGCTTTTGTTCAGGTAAAGCTGGAAGAGAACGGGAGAGCTAGGGAGATATGTGCAATTATGTATGGTTTTACTAAATGACTGTTTTATTTGGTCAAAATAGTTGAATTTTTATTCACACAGTAAGCATTACATTCCAAGGTAAGGCAACAAGTGATGAGATATTTTTGTGCCGAAACAACTCAGTTTCCAGGCTCATGCCGTTGCACGGTGCGCACGCACTTTTTAGTTCGCCGGAAAGTCACTTTAGAAAAAGAGTTCGCTCTCGACCGGTCACGTCTTCTTCACGAATCGCAAAGCAGATGATCGATTACCGGTACGTATCTAGGAAGCAT
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01000483 Download
Protein sequence
Protein sequence
MNSLSMVEARLPPGFKFHPRDDELVLDYLSKKLGGDGGAVVSIYGCPTMVDVDLNKCEPWDLPEIACIGGKEWYFYSLRDRKYATGQRTNRATESGYWKATGKDRPISRKGLLVGMRKTLVFYQGRAPKGNKTEWAMHEFRKEGQGDPMKLPFKEDWVLCRVFYKSRATIAKSPTESSYYIDSAAASSLPPLIDNYIAFDQHGAVQNLEGYAQVPCFSNNPSQPSSSMNLPLTSPMVDPEQHMGKSIKDVLSQFTMFEGNMKRQASQSNFAHQDGFEYLAESGFSQMWNELS
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above