gene PH01000464G0470
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01000464:304894 - 311215(- stand)   Name
Alternate name Locus tag PH01000464G0470
Length of gene 6322  bp Length of CDS 1938  bp
Product information
Feature type
CDS
Product name
respiratory burst oxidase
Alternate name
Molecular weight
(predicted)
72856.2183200002  kDa
Isoeletric point
(predicted)
9.52996444702148
Length
645  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
SNP ID Position Base in Scaffold Polymorphism
PH01SNP02787610 PH01000464:306126 C C_T
PH01SNP02787620 PH01000464:306139 A A_G
PH01SNP02787630 PH01000464:306224 T T_C
PH01SNP02787640 PH01000464:306298 G G_A
PH01SNP02787650 PH01000464:306676 T T_C
PH01SNP02787660 PH01000464:308871 G G_C
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_127219 17
Please click OG5_127219 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
Gene ID Short description Curator summary Computational description E-value
AT5G60010.1
ferric reductase-like transmembrane component family protein
ferric reductase-like transmembrane component family protein; FUNCTIONS IN: in 8 functions; INVOLVED IN: oxidation reduction; LOCATED IN: integral to membrane, membrane; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: L mature pollen stage, M germinat
6E-178
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os01g61880.1 respiratory burst oxidase, putative, expressed 0
 
Function (determined by interpro in EMBL-EBI)
Protein family membership
Domains and repeats
  1. Domain
  2. Domain
  3. Domain
1 100 200 300 400 500 645
Detailed signature matches
    1. PR00466 (GP91PHOX)
    1. PF08414 (NADPH_Ox)
    1. PS50222 (EF_HAND_2)
    1. PF01794 (Ferric_reduct)
    1. PF08030 (NAD_binding_6)
    1. PS00018 (EF_HAND_1)
Unintegrated signatures no IPR
Unintegrated signatures
  1. PTHR11972 (NADPH OX...)
  2. PTHR11972:SF5 (RESP...)
  3. SSF47473 (EF-hand)
  4. SSF52343 (Ferredoxi...)
GO term prediction

Biological Process

GO:0055114 oxidation-reduction process

Molecular Function

GO:0004601 peroxidase activity
GO:0005509 calcium ion binding
GO:0016491 oxidoreductase activity
GO:0050664 oxidoreductase activity, acting on NAD(P)H, oxygen as acceptor

Cellular Component

GO:0016020 membrane

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
specific 203934 75 170 4.44E-49 pfam08414 NADPH_Ox cl07149 -
superfamily 203934 75 170 4.44E-49 cl07149 NADPH_Ox superfamily - -
non-specific 203841 550 627 1.51E-09 pfam08030 NAD_binding_6 cl17716 C
superfamily 203841 550 627 1.51E-09 cl17716 NAD_binding_6 superfamily - C
non-specific 99783 520 578 2.54E-07 cd06186 NOX_Duox_like_FAD_NADP cl06868 NC
superfamily 244539 520 578 2.54E-07 cl06868 FNR_like superfamily - NC
specific 216705 337 452 8.14E-05 pfam01794 Ferric_reduct cl01043 -
superfamily 242267 337 452 8.14E-05 cl01043 Ferric_reduct superfamily - -
non-specific 238008 148 196 0.00104151 cd00051 EFh cl17302 -
superfamily 247856 148 196 0.00104151 cl17302 EFh superfamily - -
multi-dom 227455 98 195 0.00168704 COG5126 FRQ1 - C
Conserved sites/feature
Type Brief name Coordinates Complete size Mapped size Source domain
generic FAD binding pocket I560 13 1 99783
generic NAD binding pocket I560,G561 7 2 99783
generic conserved FAD binding motif 3 0 99783
generic phosphate binding motif S530 4 1 99783
generic beta-alpha-beta structure motif L555,G559,I560,G561,A562,P564 6 6 99783
generic Ca2+ binding site D149,Q155,D180,N182,D184,E191 8 6 238008
 
DNA sequence
Upstream 1000 bp region from PH01000464G0470 gene.
AACACTTGTTATGGACAAATGCAAACTTCAGAATACAGTTCCTGACTGCAGACCTAAGGTGGGCAGACCAAGAAAAGTTTATGCTATAATGGAAGGCAACACGAACAAAACGCCAGGTATGGTTCCAATATCCCGAGGAAGTGATGTTATGAGCAGTCAGATGATTATTGGAGCGGCAAATGGCCAACAGTCAAATAGCGTACCAGGGTCGCTTCCGGCTTCCGCATCCAATGATGCAACGAGTGGTGGGTTATTGATTCTCACAGAAGGAGAAAATACTCAAGTATGCCCGAATGCTAGTAATCAACCTAGAAAAAGGGGTAGGCCTCGAAAGGATAGAACTATGTCCGGTGATAACAGAACTATGTCCGGTGATAATCAACCTAAAAAAAGAGGCAGGCCTCCAAAAAACAGGAGTTTGTCTGGAAGTTCTCAGAGTGCAGGAAGCACACCAAGTTCTCTGGCGCTTGTGCCAGTGCAAGATGCAAGTGTCGCAACTGATATGCAAGAAGCTTCTAGGATACAGAACAGTGTTCGTAAGCGCAATACACAGACAGTGAAGGCAGAAAAACTGAAGAGAGAAAATTTGCGTGTTCAAGGCGCAACACCTGGAACTCAATTATTCTAGCAAGCAATCTCATTGTTCCAATATAAATATCTCTAAACATTCCAGAATCTATGTATGATGGTGACACTAGCTTTCAACATACTTTGTACAACCCAGCGTACAACAAAACTTGTAAAGCTATATTTGCTATCCGAATGCTATCGTATTTCTTTTCCTATGCAAGTATATTTGCAATCTGTTTAAAATTCTTCTGGTATGGTCTTAGAAGTTTTCCTTGTGGAAATGGAACCTAGTTGTGGTTGTCTGACTGAATTCCTTTGAAAGATCCTTGAGTTGTTTCGTGAGCGTTGGAGATCCACAATAGAAAACACCTGCAGATTCATGTACATATTAACTATTGTAGTGTGAAGTTTAAATCTGTCATCACATGATG
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGGCGTCGTCGAGCGGGTACGCCGAACAACCGCCGCTGGACGGCATCACCACCGACAGGGTGCAGCAGCCGGCGGCGCCGGGAGGTTGGTCCGCGCGGGGGCTGATGAAGCAGCCGTCGCGGCTGGCGTCGGGGGTGCGGCAGTTCGCGTCGCGGGTGTCGATGAAGGTGCCGGAGGGGGTGGCCGGCATGGGCATGCGGCCGGGGCGGATGACGCGGATGCAGTCTAGCGCCCAGATGGGGCTGCGCGGCCTGCGCTTCCTCGACAAGACGTCCGGCGGCAAGGAGGGCTGGAAGGCCGTCGAGCGCCGCTTCGACGAGATGAACAAGGCCGGACGCCTCCCCAAAGAGAGCTTCGGCAAGTGCATCGGCATGGGGGACTCCAAGGAGTTCGCCGGCGAGCTGTTCGTGGCGCTGGCGAGGCGGAGGCACCTGGAGCCGGACGACGGCATCACCAAGGAGCAGCTCAAGGAGTTCTGGGGGGAGATGACCGACCAGAACTTCGACTCGCGGTTGCGCATTTTCTTTGACATGTGCGACAAGAACGGCGATGGGATGCTCACAGAAGATGAGGTCAAAGAGGTTATTATATTGAGCGCGTCGGCGAACAAGCTGGCCAAGCTGAAGGGTCACGCCGCGACCTACGCGTCGCTGATCATGGAGGAGCTCGACCCCGACGACCGCCGCTACATCGAGATTTGGCAGCTGGAGACGCTGCTGCGCGGGATGGTGAGCGCACAGGCGCCGGAGAAGCTGAAGCGGTCGACGTCGAGCCTGGCGAGGACGATGATCCCGTCGCGGTACCGGAGCCCGCTGAAGCGGCACATCTCCAAGACGGTGGACTTCATCCACGAGAACTGGAAGAGGATATGGCTCCTGACGATGTGGCTGGCCATCAACCTCGGACTGTTCGTGTTCAAGTTCGAGCAGTACAAGCGCCGGGCCGCGTTCCAGGTGATGGGCTACTGCGTCTGCATCGCCAAGGGCGCCGCCGAGACGCTCAAGTTCAACATGGCGCTCATCCTCCTGCCCGTGTGCCGGAACACGCTCACCACGCTCAGGTCCACCGCGCTCAGCCGGGTCATACCCTTCGACGACAACATCAACTTCCACAAGGTCATCGCGCTGTCGATCGCGATCGCAACGACGATCCACACGCTCGCCCACGTCACCTGCGACTTCCCAAGGCTGATTGCCTGCCCGAGGGATAAGTTCATGGCCACCTTGGGGCCGAACTTCAACTTCAGACAGCCGACGTACCCGGACCTGCTGGCGAGCGCCCCCGGGGTCACCGGCATCCTCATGATCGTCATAATGTCATTCTCCTTCACGCTGGCGACGCACTCCTTCAGGCGGAGCGTCGTGAAGCTGCCGTCGCCGCTGCACCACCTGGCTGGTTTCAATGCCTTCTGGTACGCCCACCACCTGCTGGTGCTCGCATATGTCCTCCTGGTAGTGCATTCCTACTTCATATTCCTCACCAGGGAGTGGTACAAGAAGACGACATGGATGTACCTGATAGTCCCTGTCCTCTTCTATGCCTGCGAGAGAACGATCAGAAAAGTTCGTGAGAACAACTACCGCGTCAGCATCGTCAAGGTCCTTATTGACGGCCCTTATGGTGCACCAGCGCAAAATTACAAGAAATACGACATTCTTTTGCTTATTGGTCTTGGAATCGGTGCCACTCCTTTCATCAGCATACTGAAAGATCTCTTGAACAATATAAAGTCCAACGAAAATGTCATAGAGATGCACAATTACCTGACCAGTGTGTATGAAGAAGGCGACGCAAGGTCAGCACTGATTGCCATGGTTCAGTCACTTCAACATGCCAAAAATGGCATGGATATCGTCTCTGGCAGCAGGGTATTTGCCCGCCTACTCCTTTTTCTATCTGAAGATGAATATGCCTATGCTCTTGCTTCCTTTGTCTGA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01000464G0470 gene.
GCAGCCTACGAGTCACGTACGTATTTATATACCTACAAAAATGCGTACTACTGTTAGTGGCGGCAACCAATCCATGCATGCATATACATGTTACTAATCTGACTAGCAACAACGCCCTTAATTTGGCCTTTTAATTTTCCCTTATGGAGTTGCAAGGCCATGTACAAGACGTCCAAGGAGCGCGTCATGAGGAGGCGTGTGGTGCTGGAGCAGAAGAAGGCGATGACGTGGCTGGACAACGAGCGCTACCTCGCCGTCGTCAACCACCTGGCCGGCACCGGCAACCCAGAGGCCTGCTTCATCGTCTGCCTCACGCTCATCTTCGCGCACCAGGACATGCAGCGCAACCCCGTGTGCCTCGACCGGGTAGCCGTCGTCGGCCACAAGGTTGTAACCTACGTGCTTGGCCTCCTCTTCTACACGGCCGGCGAGGCACTCGACGTTGGGAAACACTACATCAGCCAGGTCGAGAGCGAGCCGGCCAGCGGTGGGTACGAGACGGCCAAGAGGACCAACCGGGAGTGCAGGTGTTGCCGGAGGCTCCCTATGGACGCGGTCCGGGAGGCAACGTGGAAGAAGATGGCCGAGCCGGGTGTTGGCGCTGCCGGAGGACAGCCACCGGCGCACGAGCACCATCTGTGGTGTGATGGAAGGGGGGTGACTACGTCGTCTTCTGCAGTGTTGGCTGTAGGATTATGCATGAATACGTCAAGTTCTTTGCACAGGTGTTGAACTACTTGTCGTGAACTTAGCGGTTTTAGCATAGGTTTAGCAAATATTCAGATATAGTTCCTCGCCATTTTTGTCAATATTCTTCACTAATTAAATATGACAACTGCAAATTAGACTTTGAGCTCAAAATAATGCTTTACTAATATGTGAATGTGTCATATGTTCTGAATTTGCATTTATGTATATGAGAATGTATATTATCACAGACGGTTATTTATTGGAACCGTCTGTGATGTGTATTTACCACAGATGGATCTACTTTAGAACCG
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01000464 Download
Protein sequence
Protein sequence
MASSSGYAEQPPLDGITTDRVQQPAAPGGWSARGLMKQPSRLASGVRQFASRVSMKVPEGVAGMGMRPGRMTRMQSSAQMGLRGLRFLDKTSGGKEGWKAVERRFDEMNKAGRLPKESFGKCIGMGDSKEFAGELFVALARRRHLEPDDGITKEQLKEFWGEMTDQNFDSRLRIFFDMCDKNGDGMLTEDEVKEVIILSASANKLAKLKGHAATYASLIMEELDPDDRRYIEIWQLETLLRGMVSAQAPEKLKRSTSSLARTMIPSRYRSPLKRHISKTVDFIHENWKRIWLLTMWLAINLGLFVFKFEQYKRRAAFQVMGYCVCIAKGAAETLKFNMALILLPVCRNTLTTLRSTALSRVIPFDDNINFHKVIALSIAIATTIHTLAHVTCDFPRLIACPRDKFMATLGPNFNFRQPTYPDLLASAPGVTGILMIVIMSFSFTLATHSFRRSVVKLPSPLHHLAGFNAFWYAHHLLVLAYVLLVVHSYFIFLTREWYKKTTWMYLIVPVLFYACERTIRKVRENNYRVSIVKVLIDGPYGAPAQNYKKYDILLLIGLGIGATPFISILKDLLNNIKSNENVIEMHNYLTSVYEEGDARSALIAMVQSLQHAKNGMDIVSGSRVFARLLLFLSEDEYAYALASFV
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above