gene PH01000437G0190
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01000437:160270 - 167239(+ stand)   Name
Alternate name Locus tag PH01000437G0190
Length of gene 6970  bp Length of CDS 1038  bp
Product information
Feature type
CDS
Product name
bZIP transcription factor
Alternate name
ABF
Molecular weight
(predicted)
37210.71632  kDa
Isoeletric point
(predicted)
9.11430740356445
Length
345  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
(0 result)
SNP ID Position Base in Scaffold Polymorphism
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_144915 8
Please click OG5_144915 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
(0 result)
Gene ID Short description Curator summary Computational description E-value
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os02g52780.2 bZIP transcription factor, putative, expressed 2E-105
 
Function (determined by interpro in EMBL-EBI)
Protein family membership

None predicted.

Domains and repeats
  1. Domain
1 50 100 150 200 250 300 345
Detailed signature matches
    1. PF00170 (bZIP_1)
    2. SM00338 (BRLZ)
    3. PS00036 (BZIP_BASIC)
    4. PS50217 (BZIP)
Unintegrated signatures no IPR
Unintegrated signatures
  1. PTHR22952 (CAMP-RES...)
  2. SSF57959 (Leucine z...)
GO term prediction

Biological Process

GO:0006355 regulation of transcription, DNA-dependent

Molecular Function

GO:0003700 sequence-specific DNA binding transcription factor activity
GO:0043565 sequence-specific DNA binding

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
KEGG orthology Functional Subsystem Pathway
Environmental Information Processing Signal transduction Plant hormone signal transduction  
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
ID for KEGG orthology Reaction description EC number
K14432 ABA responsive element binding factor
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
specific 197664 258 282 7.23E-09 smart00338 BRLZ cl02576 C
superfamily 243100 258 282 7.23E-09 cl02576 B_zip1 superfamily - C
non-specific 201054 259 282 8.07E-08 pfam00170 bZIP_1 cl02576 C
non-specific 203738 258 282 0.000181288 pfam07716 bZIP_2 cl02576 C
non-specific 213400 259 282 0.000511248 cd12193 B_zip1 cl02576 C
Conserved sites/feature
(0 result)
Type Brief name Coordinates Complete size Mapped size Source domain
 
DNA sequence
Upstream 1000 bp region from PH01000437G0190 gene.
GGTTCAAAAAAACAAGTCATTTTGGATATCGACATGATCCCAAAATACAACTTTGATCACTAATTACTATTATAATATATTATATTTGTAAAGCTCAATAAAATTATAATATTATGAAAGTACTTTTCAAGACGAATCGTGTATATCTAATCTAAATATTTAAAATTATATCGATAACCAAAGTTTCTCATATTTGATTGTACGCGTTCCAAAAACGATTTGTTTTTTTGTGAAATAAAGTGAGAATCCAACAAGAAGTTCGAACGGTCGCAAACGCCTTAAGTTTCCAAAAGCCTATTTGAGAAAGCTTCCTTTTCAGCGTAAAATTATCAAGACCGTCATAAGTAGGCTCTGAAACTTTCTCGATACGATGACACGCTTCTGGTGTTGGGCACTTTAAACCTGGTGCGACATTGAACGCGAGCGGGCGATGTGGGCGGTGTGCTTCGTCCAAGGCATAAAAATAATCGGCCGCTGGGCCCACGCGGTTTCGCGGGAGCCATACGGTCCGGAGGAACCGCACACGAGACCGCCGCGCCCGAATTACTGCGTGTTGGGCAGGGCGCACAAGGCAAACGCGCTCAGCCCATCGCATCTCACGCCTATATTAATCGGCCGCTGGGCCACGCGGTTTCGCGGGAACCCGCCATACGGGCCGGGGGAACCGCACACGAGACCGCTGCGCCCGCATTACTGGGTGTTGGGCAGGGCGCACAAGGCAAACGCGCTCGGCCCATCGCATCTCACGCCAGTCCAGGGCGAGGCGGAGACGCTGCTGCGGTCGCGCGGCCGGCGGCCCGCGTCGCGTCACGGCCTGTGGTGGGTGGGGTGGTCCGCCACGACGATCCGTCCGTCGAACCGGTTTGTCCGCGCGCGCCCGGATGCTCCCACCTCGCGGCCTCCCATTGGGCAGCTCGTCGCGTCGCCACCCGCCCGCGTCGTGCGGAGGCCGACACGTTGCGCCCTCCCGAGAGGCGGAGCCCACCACGTTCTGTTCTGCC
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGGATTTCCCGGGAGGGAGCGGGAGGCAGCAGCTGCCGCCGATGACGCCGCTGCCGCTGGCGCGGCAGGGGTCGGTCTACTCGCTGACGTTCGACGAGTTCCAGAGCACGCTCGGCGGGGCCGGGAAGGACTTCGGATCCATGAACATGGACGAGCTTCTCCGGAACATCTGGACGGCCGAGGAGTCGCACGCCATCGCCGCGTCCGCCGCCACCACGTCGTCGTCCGCGGCGGTGGACCACGCCGCGGGGGCGCCTATCCAGCGGCAGGGTTCGTTCACCCTCCCCCGCACGCTCAGCCAGAAGACCGTCGACGACGTCTGGCGCGACATGATGTGCTTCGGGGCCCCGTCCGCAGCGGCGCCCCCGCCGGCCCAGCGGCAGCAGACTCTTGGGGAGGTAACGCTGGAGGAGTTCCTCGTGCGCGCCGGCGTGGTCCGGGAGGACATGGCGGCCGGGCCGCCCGTCCCGCCCGTGCCCGTGCCCGCGCCTGCCGCCCAGGCCCCGCCCCCACCTCCGCAGCCGCCGGTGCTGTTCCCTCAGAGCAATGTGTTTGCTCCTATGGTGCCTCCGCTGTCGTTGGGGAATGGTTTGATGACCGGAGCTGTCGGCCAGGGAGGTAGCAGTGCGGGTACGGTGAGGCCGGTTACATTCAACGAGTTTGGCAAGATGGGACGCGGGGACTTGCCATCGCTGTCATCACCACCGGTGCCGTACGTTTTTAATGGTGGGTTGAGGGGGAGGAAGGCATCAGCCACGGAGAAGGTGGTCGAGAGAAGGCAGCGGCGGATGATCAAGAACCGGGAGTCTGCAGCGAGGTCGCGCCAGAGGAAGCAGGCTTATATGATGGAGTTAGAAGCTGAGGTGGCAAAACTTAAAGAGCTGAAAGAGGAGTTGCAGAAAAAGCAGGTGGAAATGGTAGAGAAGCAGAAGAATGAGGTAATTGTTACCGTTTCGGAGAAATTGCTTTTGCTCTGGACAGATTCTACCTTTGCTTATTTACATGTCAAAGAAAAACAGAACCAAGCAGTGCCATAG
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01000437G0190 gene.
AAAAACTCTTTGAATTGGTCAGCCAACTACCATCATCGTTGTCGACCATGTAGTCTACAATTTTAGTTCGTGATTCGTCTATTGATCCTAATGCTTCATTGTACGGTTAACTATGTTTTGCTCAATATTTTTTTCCAACTCTTCCAACTATTTTAATGGCCACATTGTCAATCTGCAATACTGTCTTATCCTAAGAAAATGTTGGGAAGGGCAAACAAAATATACGAGTGTAATTTTTACACCAGAGATTAAATGTGTGTTTAGTTAATATATATGTTTCCATCCGATTGAAAAGAGTATGTTAACAGTATTTCCCCAATATAGCACCTCAAAGTTATTTTGCATAGTGTATTTTGCATGTTGAACCACTATTTCTTTGATGTGTCAGCCTTCAGATTCTTGGTTCAGTTTCCACGCTACATAATTATCTTTTGTTAAAAGGGTAAAGGATGAAACTGCTGCTATTATTCTCATAAACTATGGATTCAATTTCCAAATAGTAAAACATACCTCAAATTCTTTGTAGTTTCTACAGTTCTTTGGTTTGGGTTGATGACTTTGTAATGAGATTTTTGTCCCGTCAGCTCATTATCTGAGAGAAGTTTGACAACTCTTGGTTGGTGTTAGCAAATTTGCGATTGAGATTTCCAGACTTTGCTGTTCCTAATTTTTACTTTTGAATAAGTGATTGTTCCTTATGGTTCTATAGATATTGTCATATGAAGTTCCAAGATTGCCTCGTTGACATTTTTTAAGCCCAAACATAATTATTGAATGGTTTTTGCAGGTCCTGGAGAGAATTACCCGAAAAATTGGACCTAAGCCGAAGAGAATTTGCCTGCGGAGGACACTGACGGGTCCTTGGTAAGCAGAAGACTTGTAACTAGAACACACTACTAGCAAGTAGCAACGTGAGCAGCGTATACAGTAGGTGAATTCAGAATCGCCAGAGTTGCCCTTGTAGAGCAGCCATTGATCCGATGCTTCGGAGTCCTAGGCAA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01000437 Download
Protein sequence
Protein sequence
MDFPGGSGRQQLPPMTPLPLARQGSVYSLTFDEFQSTLGGAGKDFGSMNMDELLRNIWTAEESHAIAASAATTSSSAAVDHAAGAPIQRQGSFTLPRTLSQKTVDDVWRDMMCFGAPSAAAPPPAQRQQTLGEVTLEEFLVRAGVVREDMAAGPPVPPVPVPAPAAQAPPPPPQPPVLFPQSNVFAPMVPPLSLGNGLMTGAVGQGGSSAGTVRPVTFNEFGKMGRGDLPSLSSPPVPYVFNGGLRGRKASATEKVVERRQRRMIKNRESAARSRQRKQAYMMELEAEVAKLKELKEELQKKQVEMVEKQKNEVIVTVSEKLLLLWTDSTFAYLHVKEKQNQAVP
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above