gene PH01000433G0800
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01000433:493659 - 496881(+ stand)   Name
Alternate name Locus tag PH01000433G0800
Length of gene 3223  bp Length of CDS 765  bp
Product information
Feature type
CDS
Product name
ferritin-1, chloroplast precursor
Alternate name
FTH1
Molecular weight
(predicted)
27908.6240199999  kDa
Isoeletric point
(predicted)
5.43849563598632
Length
255  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
(0 result)
SNP ID Position Base in Scaffold Polymorphism
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_127547 2
Please click OG5_127547 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
Gene ID Short description Curator summary Computational description E-value
AT2G40300.1
ferritin 4
Encodes FERRITIN 4, AtFER4. Ferritins are a class of 24-mer multi-meric proteins found in all kingdoms of life. Function as the main iron store in mammals. Evidence suggests that Arabidopsis ferritins are essential to protect cells against oxidative da
ferritin 4 (FER4); FUNCTIONS IN: oxidoreductase activity, ferric iron binding, binding, transition metal ion binding; INVOLVED IN: in 8 processes; LOCATED IN: mitochondrion, chloroplast stroma, chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant str
3E-99
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os12g01530.2 ferritin-1, chloroplast precursor, putative, expressed 1E-134
 
Function (determined by interpro in EMBL-EBI)
Protein family membership
Domains and repeats
  1. Domain
  2. Domain
  3. Domain
1 50 100 150 200 255
Detailed signature matches
    1. PTHR11431 (FERRITIN)
    1. SSF47240 (Ferritin-...)
    1. PS50905 (FERRITIN_LIKE)
    1. PF00210 (Ferritin)
    1. PS00204 (FERRITIN_2)
Unintegrated signatures no IPR
Unintegrated signatures
  1. PTHR11431:SF8 (FERR...)
GO term prediction

Biological Process

GO:0006826 iron ion transport
GO:0006879 cellular iron ion homeostasis
GO:0055114 oxidation-reduction process

Molecular Function

GO:0008199 ferric iron binding
GO:0016491 oxidoreductase activity
GO:0046914 transition metal ion binding

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
KEGG orthology Functional Subsystem Pathway
Metabolism Metabolism of cofactors and vitamins Porphyrin and chlorophyll metabolism  
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
ID for KEGG orthology Reaction description EC number
K00522 ferritin heavy chain EC:1.16.3.1
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
specific 153114 88 247 2.49E-74 cd01056 Euk_Ferritin cl00264 -
superfamily 241737 88 247 2.49E-74 cl00264 Ferritin_like superfamily - -
non-specific 153098 89 247 2.46E-41 cd00904 Ferritin cl00264 -
non-specific 153113 91 249 1.89E-30 cd01055 Nonheme_Ferritin cl00264 -
non-specific 224445 93 250 1.95E-24 COG1528 Ftn cl00264 -
non-specific 182367 94 249 1.96E-05 PRK10304 PRK10304 cl00264 -
non-specific 153097 92 146 0.00423545 cd00657 Ferritin_like cl00264 C
multi-dom 215791 91 236 1.81E-30 pfam00210 Ferritin - -
Conserved sites/feature
Type Brief name Coordinates Complete size Mapped size Source domain
specific ferroxidase diiron center E101,Y108,E135,E136,H139,E185,Q219 7 7 153114
specific ferrihydrite nucleation center E131,D134,E135,E138 4 4 153114
specific iron ion channel H196,D209,E212 3 3 153114
 
DNA sequence
Upstream 1000 bp region from PH01000433G0800 gene.
TACTTTTCCCATTCCTTACTCCTCTCTCCCTCCACTCAATTTTGTCAACTAGAGTAGCAACGGCCGATGGGCCACTAGGTGCTTTGGATAGTAATGGGTGGATTTACTCGATGCACTGCTCATTCAAAGCTCTTCACGGTCGACGCGGCGTGGCAATGCCTGGACAGCAAGTGGCTCTTCTTCGGGGCGACTCCAACCACGTCGACACCATCTGGAACCTCCTGGCCTTTGTTCTTGGAGTCACGGAGTATGCTGCACAATTCTGGGCCGGAGTTATGGCTGAAGTGCGAGCACGTGGGCACGCCGTGCCGAGGGTGTTCTACCGCGCCGCCGCCAACAGATCGCAGGCATAGGTGGTTTGTCCAATGTCGGTGGCTCGTGCTACTGTATTCTTCGCCCTCAGAAACGGAACTGATCGGTGCCGTGTGCATGGCCCCGTTGAGGCTTTGCTATTGTGGAAGGTGAGCAAGACGAGCGCTGCATGCCATGGCGTCCTCGACACAGATGCAGGTGTCGTTGTTCATCCTGGGGAAGGAGGAGAGCACGAGAAGTCTGTGCACCAGGTTGATGGCGTAGACAAACACATCGCCTCGATGAGGAGAGGGTGGGCGGAGAAACAACGATAAGTTGGAAGGAGGATACCAGAAACTGGTTTTGTTAAAAACCACATATACTCGTTTTTCACAAAACAGGGAATTATGGGTTTAGGGGGAAACGAGTTTTCCTTATCCACAGGTTAGTTAGATCATCCAAACAAGGATCTTCAAAATCAGACTTAAAGCAATTTTAGTAAACCTGGTTTTCACAAAACACCTGATCCAAGATCACAGCAAGATAACAAGACAGGTACGAAGAGAAAATATCCCCGGTCTGTGCGCTCGCCGGCCACGCGCCCTCCGCGCGCACCCGTTGCCTACGTTCCATCCCTGCCGTCCACGTGTCTCCGCATCCGCGAAGCCCACGCGCCTATACCTGTCCATCTAGTCTACACCCGCAAACTC
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGCTTCTTAGGGTTACGCCCTCTCCGGCCGCCGCCGCCGCCCCGGCAGCTAACCAGCTCGCTGGAGCGGGCGCGACCCCGGCTTCCGCGAGGTTGGCTGCGCCGCGCGGCCTGCCGTCTGCTGGGACGGTGTGCAAGGCGGCGGGGAAGGGGAAGGAGGTGCTCGGCGGGGTGGTCTTCCAGCCATTCGAGGAGTTGAAGGGGGAGCTGTCTCTCGTGCCGCAGGGAGCGGGCCAGTCGCTGGCGAGGCACAAGTTTGTTGATGAGTGCGAGGCCGCCATCAACGAGCAGATCAATGTGGAGTACAACGCCTCGTACGCGTACCACTCCCTCTTCGCCTACTTTGACCGCGACGACGTGGCTCTCAAGGGATTTGCCAATTTTTTCAAGGAATCAAGCGACGAGGAGAGGGAGCACGCCCAGAAGCTCATCAAGTACCAGAACATTCGCGGAGGCAGGGTGAGGCTCCAGTCCATTGTCACACCCTTAACCGAGTTCGACCACCCCGAGAAAGGCGATGCTTTGTATGCTATGGAGTTGGCTTTGGCTCTTGAAAAGCTGGTAAATGAGAAGTTGCACAACCTGCACAGTGTAGCATCAAGGTGCAACGATCCTCAGCTGACTGACTTCATCGAGAGTGAATTCCTTGAGGAGCAGGTTGAAGCCATCAAGAAGATCTCTGAGTACGTCGCGCAGCTCAGAAGAGTGGGCAAGGGGCATGGGGTGTGGCACTTCGATCAGATGCTGCTTGAGGAAGAAGCGGCT
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01000433G0800 gene.
TACTGTTGGGTTGTTTGTCCCTATACTAGTACTAGAGAGAGGCATCTGGTACTCACTCGAAATAAAACACGGGCGATATATTTCGTTCGATTCCGGTCTAAAATGCTGCGAGTCGTATGTATACTCTCGTTCCTTCCTTCCATTGTGTTCAACTAATTAATGTACTACTGCTAGTGCTAGCTTGAAGCCTGTCAACGTCTTACTGCTGAGCACTGACTGTCGAGCCATATGCATTTTATTTTTTGTGTGGAAAAACCTAAGGATCAATGTTATACTGCTGAATTTAGGCATTGCAGAAAAGCTCTTTTCGGGATCACAAATTGAACATCCTGGTTCTGTTCTTGTTGGAATTTCAAAAGTTTGTCAAATTTCAGTTTGAATTCAAGTTTCAATCTCCCAGTTCTTTTCTTGGGCCTTGCCCCATTTCCTTCTTCCTGGGCTTTTCTCCCCTGGCCCTGGTCTCTTTACCTCCCCCTAGCCCAGCCCAGGCTGGCACCATACGGAGGGCTCTAGCCGCACGCGCACGCTCCCTCGCTGCGTCCCTGCACGGCGCCGCTTCCTTCGCGCCTAGCTCGACATCCCCCAAAACCTCCTCTCCCCCTTTGGCTATAAAAGCCGGCACCTCCCCACCTTGCTCCCCCTTCCCCACCATTCTTCTCCTCTCCCACTCCTTCACTGAGCAAAGTCAGAGCCGAGCACCCATGCACCACTGCCGTCGAGTCGCCGCTCTGGTGAGCTTTTCGTCGAACCTGCCGCGTCACAGCGCGTTCCCAACCCTCCACTTTTCCCCCACCTTTATTCTTCTACTTTGCCGCTATGGAGCTCCCTCACCGCCACTACTTCTTCTCCACCATCGGCCGTCGTTGCCCCGCCACCTCAGCCGCCCTCAAGCCTCCTCGACCTCACCTTCGAACTCCCCATCCTCGGGCGCAGCCCGTTCGCACGCCTTCCTCCCTGCGCCACCTGCTCGCCGGTGCCATATACACCCATGCACCTGCCAC
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01000433 Download
Protein sequence
Protein sequence
MLLRVTPSPAAAAAPAANQLAGAGATPASARLAAPRGLPSAGTVCKAAGKGKEVLGGVVFQPFEELKGELSLVPQGAGQSLARHKFVDECEAAINEQINVEYNASYAYHSLFAYFDRDDVALKGFANFFKESSDEEREHAQKLIKYQNIRGGRVRLQSIVTPLTEFDHPEKGDALYAMELALALEKLVNEKLHNLHSVASRCNDPQLTDFIESEFLEEQVEAIKKISEYVAQLRRVGKGHGVWHFDQMLLEEEAA
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above