gene PH01000419G0780
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01000419:604718 - 614786(- stand)   Name
Alternate name Locus tag PH01000419G0780
Length of gene 10069  bp Length of CDS 2718  bp
Product information
Feature type
CDS
Product name
dynamin
Alternate name
DNM
Molecular weight
(predicted)
98544.3729200003  kDa
Isoeletric point
(predicted)
9.28483200073242
Length
905  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
(0 result)
SNP ID Position Base in Scaffold Polymorphism
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_147170 4
Please click OG5_147170 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
Gene ID Short description Curator summary Computational description E-value
AT1G59610.1
dynamin-like 3
A high molecular weight GTPase whose GTP-binding domain shows a low homology to those of other plant dynamin-like proteins.Contains a pleckstrin homologous domain. DRP2B and DRP1A participate together in clathrin-coated vesicle formation during endocytosi
dynamin-like 3 (DL3); FUNCTIONS IN: protein binding, clathrin binding, GTPase activity; INVOLVED IN: synaptic vesicle endocytosis; LOCATED IN: clathrin-coated endocytic vesicle, plasma membrane, vacuole; EXPRESSED IN: 27 plant structures; EXPRESSED DURING
0
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os06g13820.2 dynamin, putative, expressed 0
 
Function (determined by interpro in EMBL-EBI)
Protein family membership
Domains and repeats
  1. Domain
  2. Domain
1 100 200 300 400 500 600 700 800 905
Detailed signature matches
    1. PR00195 (DYNAMIN)
    2. PTHR11566 (DYNAMIN)
    1. PF00350 (Dynamin_N)
    2. SM00053 (DYNc)
    1. SSF52540 (P-loop co...)
    1. PF01031 (Dynamin_M)
    1. PS50003 (PH_DOMAIN)
    1. PS51388 (GED)
    1. PS00410 (DYNAMIN)
Unintegrated signatures no IPR
Unintegrated signatures
  1. SSF50729 (PH domain...)
GO term prediction

Biological Process

None predicted.

Molecular Function

GO:0003924 GTPase activity
GO:0005515 protein binding
GO:0005525 GTP binding
GO:0005543 phospholipid binding

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
specific 206738 39 306 1.24E-49 cd08771 DLP_1 cl17170 -
superfamily 247724 39 306 1.24E-49 cl17170 Ras_like_GTPase superfamily - -
non-specific 216255 297 497 8.27E-23 pfam01031 Dynamin_M cl03076 N
superfamily 216255 297 497 8.27E-23 cl03076 Dynamin_M superfamily - N
non-specific 197491 41 208 6.61E-17 smart00053 DYNc cl17170 -
non-specific 241268 580 697 2.78E-08 cd01235 PH_Sbf1_hMTMR5 cl17171 -
superfamily 247725 580 697 2.78E-08 cl17171 PH-like superfamily - -
non-specific 241404 580 698 1.18E-07 cd13250 PH_ACAP cl17171 -
non-specific 241455 575 702 3.57E-07 cd13301 PH1_Pleckstrin_2 cl17171 -
non-specific 241283 580 698 6.13E-07 cd01252 PH_GRP1-like cl17171 -
non-specific 241417 577 702 8.36E-07 cd13263 PH_RhoGap25-like cl17171 -
non-specific 214574 580 697 9.64E-07 smart00233 PH cl17171 -
non-specific 215766 580 696 1.11E-06 pfam00169 PH cl17171 -
non-specific 241430 579 697 2.30E-06 cd13276 PH_AtPH1 cl17171 -
non-specific 241436 579 697 1.33E-05 cd13282 PH1_PLEKHH1_PLEKHH2 cl17171 -
non-specific 241231 580 691 1.35E-05 cd00821 PH cl17171 -
non-specific 241445 580 697 6.68E-05 cd13291 PH_ORP10_ORP11 cl17171 -
non-specific 241529 575 696 7.28E-05 cd13378 PH_RhoGAP2 cl17171 -
non-specific 241443 580 623 0.000103701 cd13289 PH_Osh3p_yeast cl17171 C
non-specific 241452 579 699 0.000110241 cd13298 PH1_PH_fungal cl17171 -
non-specific 241296 580 623 0.00011663 cd01265 PH_TBC1D2A cl17171 C
non-specific 241414 580 623 0.000242399 cd13260 PH_RASA1 cl17171 C
non-specific 241409 577 614 0.000410784 cd13255 PH_TAAP2-like cl17171 C
non-specific 241427 577 623 0.000550465 cd13273 PH_SWAP-70 cl17171 C
non-specific 241438 580 623 0.000823503 cd13284 PH_OSBP_ORP4 cl17171 C
non-specific 241369 580 696 0.000869184 cd13215 PH-GRAM1_AGT26 cl17171 N
non-specific 241470 579 623 0.00105893 cd13316 PH_Boi cl17171 C
non-specific 241442 579 623 0.00154749 cd13288 PH_Ses cl17171 C
non-specific 241278 580 616 0.00173721 cd01247 PH_FAPP1_FAPP2 cl17171 C
non-specific 241530 575 696 0.00236651 cd13379 PH_RhoGap24 cl17171 -
non-specific 241407 577 623 0.00349359 cd13253 PH1_ARAP cl17171 C
non-specific 241437 580 623 0.00372527 cd13283 PH_GPBP cl17171 C
non-specific 206739 39 85 0.00450547 cd09912 DLP_2 cl17170 C
non-specific 241402 579 623 0.0080215 cd13248 PH_PEPP1_2_3 cl17171 C
multi-dom 215874 39 207 2.48E-37 pfam00350 Dynamin_N - -
Conserved sites/feature
Type Brief name Coordinates Complete size Mapped size Source domain
specific GTP/Mg2+ binding site N43,G45,A46,G47,K48,S49,A50,T63,G64,T69,D144,K206,D208,Q209,I241,G242,Q243,S244,V245,A248 20 20 206738
specific homodimer interface I44,G45,I148,R151,M176,D180,A182,S183,S184,R185,L187,R188,Q209,T211,G212,D213,A214,S244,V245,A246 20 20 206738
specific Switch I region I73,V74,V75 3 3 206738
specific Switch II region P146,G147,A167,I168 4 4 206738
specific G1 box G42,N43,I44,G45,A46,G47,K48,S49 8 8 206738
specific G2 box T69 1 1 206738
specific G3 box D144,L145,P146,G147 4 4 206738
specific G4 box S205,K206,I207,D208 4 4 206738
specific G5 box I241,G242,Q243 3 3 206738
 
DNA sequence
Upstream 1000 bp region from PH01000419G0780 gene.
TGAGCAATTTTATAATGTTTCGAACTGTACTTGCTCTTAGATCTTGATGGGAGTTAAAAATTGTTGAAAATTTCAAAGTAAAATGAGAAATTAAATATGGCCGGGATTGGATAGATACCAACCCACTTACCAACTCCCAGCCAAGGTCCAGGAAACTTTTTGAAAAATGATATTTGAAACCCCCACGTGCAAGTACAAGATGAGGACCGTCCATAAAACAGTCGGTTGTTTTTAGCCTCAAAACCAGTCGATTTTATCCAACGGCTTCCCTTCTCCCCCTGTCTAATACAAATCAATCCTAGTATCTAGCTCTTCGTTCGATCGAGGGATTCTAGCGCTGCCATCGAACCCTAGCGCCACCACCTCCCAGTCGCCTCACCGGCGCCGGTGAGGCCCGTCGACCCCACCCCCGCCACCGCCCGCCGCTACTGGCTCTCTTCCTCCGCTGTCGCCGCCCGCCTTTCCCGCCGACGGCTATTGCTACTGGATCAATCACCGCCTCCTAATATTCTCTTGTTTTTGTCGTCCCCACCAACCTCCACCACCCTGCCTCGAGCCCGTGACCGACGGTGCCACCGCAACCCACCACCAGTCCTTTGCTGCCTGGCTTCCCTCTAAATACGAACCTACTAAATCCAAACCCCTAACCCGATGAACCCTAACCTTAATCTAGCAAACCACCGAGCCTTCACTGCCCTAGCTTCCCTCTAAATCCAAATCCTACTTAATCCAACCCCTAACTTGGTGAACCCTAACCTTGATCCGGCAAACCACCAACCTAACTGCTGCTGGGGAGGAAGAACCTATTGGTCGAAGCACGAATCCCTAGGCAAAATCGCAACACTAGAAATTCAACTATTTTTCCCTAACAAACATAGCAATTCCATTTTCTTTTTCTTTTAACCCGTGCAAGCAGAAGTCGCAAGTAGGGGTGGATATCAGGCCAAGTCCTCATCTTATCAAGTTTTTCCCTAAATCAATTCGATTTGATTTAATATCAT
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGGAGGAGCTGTCGCAGCTGTCCGAGTCCATGCGCCAGGCGGCCTCGCTCCTCGCCGACGACGACCCCTCCGACGACGCCGCGGCGCGGCGCCCCTCCACCTTTCTCAACGCCGTCGCCCTGGGCAACATCGGCGCAGGCAAGTCGGCCGTGCTGAACAGCCTCATCGGACACCCCGTGCTGCCTACGGGGGAGAACGGGGCGACGAGGGCGCCGATAGTGGTGGACCTGCAGAGGGACCCGGGGCTCAGCAGCAAGTCCATCGTTCTGCAGATCGACAGCAAGTCGCAGCAGGTGTCCGCAAGTGCTCTGCGGCATTCTCTGCAGGATAGGCTCAGCAAGGGTGCGTCCAGTGGATCCGGGAGGGGCCACGCAGATGAGATTTTTCTCAAGCTGCAGACGAGCACAGCTCCCCCACTAAAACTGATCGATTTACCTGGGATAGACCAGCGAGTTGTGGACGATTCAATGATCAACCAGTATGCTGGGCACAATGATGCAATACTACTAGTTGTGATACCCGCAATGCAAGCGGCTGATGTTGCATCATCTCGAGCTCTTAGGCTGGCCAAGGATATTGACTCAGATGGGACCAGAACTGTAGGTGTGCTAAGCAAAATTGATCAAGCAACTGGAGATGCGAAAACTATAGCTTGTGTTCAGGCCCTTCTGTCAAACAAGGGCCCCAAAAACCTTCCAGATATTGAGTGGGTTGCTCTAATAGGACAATCAGTTGCGATTGCATCAGCACAATCTGGATCAGTTGGGTCTGAAAACTCGCTAGAAACAGCTTGGCGGGCTGAAGCTGAAACCCTCAAATCCATCTTAAATGGAGCTCCTCAGAGCAAGCTAGGAAGGGTTGCTTTGGTTGACACCATTGCGAAGCAGATACGTAAACGGATGAAAGTGCGGCTTCCTAACCTATTGAGTGGCCTTCAGGGTAAATCCCAGATGGTGCAAGATGAACTTGCAAGGCTGGGAGAGTCGATGGTACAAAGTGTTGAAGGAACCCGGGCAGTTGCTTTGGAGCTGTGCCGGGAATTCGAGGATAAGTTTCTTGCTCATGTTACATCTGGTGAGGGATCTGGTTGGAAAATTGTTGCAAGTTTCGAAGGCAAGTTCCCTGACAGAATTAAACAGCTACCGTTGGACAGGCATTTTGATCTCAGCAATGTCAAAAGGATTGTCTTGGAGGCCGATGGTTATCAACCATATCTGATATCTCCAGAGAAAGGGTTGAGATCATTGATAAAAATAGTACTGGAAATGGCGAAGGAGCCATCACGACTTTGTGTTGAAGAGGTACATCGTGTACTTCTAGACATAGTCAATGCTTCTGCAAATGCCACACCGGGACTTGGAAGATATCCTCCATTCAAGCGTGAGGTTGTTGCAATAGCATCAAATGCATTGGAGACCTTCAAAAATGATGCCAAAAAGATGGTTGTTGCACTTGTTGATATGGAGCGCGCCTTTGTCCCCCCTCAACATTTCATCCGTCTGGTGCAAAGAAGAATAGAAAGGCAGCGTCGTGAGGATGAGATGAAAAACCGCTCTTCCAAGAAAGCACAAGAGGCTGAACAGTCCTTGACAAACAGGGCCTCTAGTCCCCAAACAGGATCTGAGCAAGCTAGTGGCAGCTTAAAATCAATGAAAGAAAAATCAAGTCAGCAAGACAAAGACACAAAAGAGGGATCAAATTTGCAGGTTGCTGGTACAGCTGGGGAAATTACTGCAGGATACCTTTTGAAGAAAAGTACAAAAACTAATGGGTGGAGCAGAAGGTGGTTTGTCTTAAATGCGAAGAGTGGAAAGCTTGGGTACACAAAGAAACAAGAGGAGAGACATTTTCGTGGTGTCATCACTCTCGAGGAATGTAACCTAGAGGAAGTAGAGGAGGAAGAACCTTCTAAAAGTTCAAAGGATTCAAAAAAGGCAAATGGGCCAGAAAAAGGCCCAAGTCTTGTGTTTAAGATAACTAACAGGGTTGCCTACAAAACAGTCCTAAAAGCTCATAGTGCTGTTGTATTGAAAGCTGAGAGCATGGCCGACAAGGTTGAGTGGGTAAATAAGATAAGAGCTGTAATTCAAAGCAAAGGGGGTTCTTTCAAGGGTCCAAATACCGAGGGTGGTTCCGTGAGACAAAGCCATTCGGATGGCTCCCTGGATAATATGGCGCGGAGACCTGCTGATCCTGAAGAAGAACTTAGATGGATGTCTCAAGAAGTTCGTGGTTATGTAGAGGCTGTTTTGAATAGTCTGGCAGCAAATGTCCCCAAGTTCTGTACACTTCATCCCTTTACTTATTTCTCAATTCTCATTACCAGTGGCCAAAGCAATGGAAAAATTGAAGAGCTTCTCCAAGAGGACCACAATGCTAAACGTAGAAGGGAAAAGTACCAAAAACAATCATCTCTCTTGTCAAAGCTTACTCGTCAACTTAGTGTACATGACAATCGGGCTGCTGTTTCTTCTTATTCTAACGATAGCTCTGAAGCTGAGAGCCCTCGGACACCCAGCCGCCCAGGCGAGGACTGGAGGTCTGCCTTCGATTCTGCAGCAAATGGCCCTGTTGATTCCAGCTCAAGCAGCAAATCAAGGTCAAGAAGTGCTGATGGTCGCAGCCGAAGCTACGAAAATGGGGATGTGAGCTCAGGTGCCAACTCTGGCAGTCGACGCACGCCAAACCGGTTGCCACCAGCGCCACCAAAATACTAA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01000419G0780 gene.
GGGTAAAATCAAATTCTTCTGTTTTTTAAAGAATTCCGTATAGCATTTTGACTCTGGGTCTCGAGCTATTGTCCCGAAGATCTGAGGCCTAGCTCTGTCTTGTCTCCCACCCAAAACCTAACATGATGAATATGAACCCTAATCTTGCTACCAGACATCATTGTTGCTAGAGAAGACGTCACGTGGTGTTGGTCGTGCGTGAACATGCTAGAGGTAGCGGTGAAGCACTATCCTTTGTGCTTCCCATTAGCATGAATTGGGATTAGATTTTGGGTTTGCTTCGGTACATACCTCTTATAAAAATTTACGAATCTTAAAGCAAAATGGTTAATATTAGGTGTTGACAAATTTTTGGCTTGTCGAATTTGTTTTAGGCTGTGTGTGATGGTTGTTGTGATAAATGGGTCTGATCTGTGTTATTGGTTGTGTTTTATAAAACCAACCCATTATTGATGTGCATCTGGAAGCCGATTTTTTGGCTCATTTAGCACGTTTTCGCTGGCTAATTGCAGTTATGACCGTATAATGCGTGTATTAGCAAAAGTGACAGCCCTGACGCACTGTAGCCATGCACCAAGGGTGCTGGCCTACGGCCACCGTGCGCCAGCGCTGCCGCGTCACCACCTGGCTCACCCGGCCCCGCTACCACTCACCCGAGCCCCGCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCGGCCCCGCCACTCACCACGACTGGCACACGGTGGCCATGCGCCAACCGCAGGCGCATGGTGCCCGTGCGCCAACCAATTAGGGCGCTCAATTAGGTTAGTTAATGGCTAGGTTAGTTAGATAATTAGTTAGGGTCTGAAATTTTAACGAATTTTAAAATATAGCAAATGAGTCCCAAAAATTATGAATTTTTTGTCGAGCCTCCTGACAACGTGTACTTGCTTGTGTAAATTTTTCATAATTTTATTCGTTCCGAATTTTCCATAATTTTCATTCTCTCGCCGTAGGTCTGTCAGGATCAATCACTT
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01000419 Download
Protein sequence
Protein sequence
MEELSQLSESMRQAASLLADDDPSDDAAARRPSTFLNAVALGNIGAGKSAVLNSLIGHPVLPTGENGATRAPIVVDLQRDPGLSSKSIVLQIDSKSQQVSASALRHSLQDRLSKGASSGSGRGHADEIFLKLQTSTAPPLKLIDLPGIDQRVVDDSMINQYAGHNDAILLVVIPAMQAADVASSRALRLAKDIDSDGTRTVGVLSKIDQATGDAKTIACVQALLSNKGPKNLPDIEWVALIGQSVAIASAQSGSVGSENSLETAWRAEAETLKSILNGAPQSKLGRVALVDTIAKQIRKRMKVRLPNLLSGLQGKSQMVQDELARLGESMVQSVEGTRAVALELCREFEDKFLAHVTSGEGSGWKIVASFEGKFPDRIKQLPLDRHFDLSNVKRIVLEADGYQPYLISPEKGLRSLIKIVLEMAKEPSRLCVEEVHRVLLDIVNASANATPGLGRYPPFKREVVAIASNALETFKNDAKKMVVALVDMERAFVPPQHFIRLVQRRIERQRREDEMKNRSSKKAQEAEQSLTNRASSPQTGSEQASGSLKSMKEKSSQQDKDTKEGSNLQVAGTAGEITAGYLLKKSTKTNGWSRRWFVLNAKSGKLGYTKKQEERHFRGVITLEECNLEEVEEEEPSKSSKDSKKANGPEKGPSLVFKITNRVAYKTVLKAHSAVVLKAESMADKVEWVNKIRAVIQSKGGSFKGPNTEGGSVRQSHSDGSLDNMARRPADPEEELRWMSQEVRGYVEAVLNSLAANVPKFCTLHPFTYFSILITSGQSNGKIEELLQEDHNAKRRREKYQKQSSLLSKLTRQLSVHDNRAAVSSYSNDSSEAESPRTPSRPGEDWRSAFDSAANGPVDSSSSSKSRSRSADGRSRSYENGDVSSGANSGSRRTPNRLPPAPPKY
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above