gene PH01000314G0470
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01000314:393655 - 395390(- stand)   Name
Alternate name Locus tag PH01000314G0470
Length of gene 1736  bp Length of CDS 1146  bp
Product information
Feature type
CDS
Product name
HSF-type DNA-binding domain containing protein
Alternate name
Molecular weight
(predicted)
40117.65332  kDa
Isoeletric point
(predicted)
4.95987319946289
Length
382  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
SNP ID Position Base in Scaffold Polymorphism
PH01SNP02050130 PH01000314:394274 C C_G
PH01SNP02050140 PH01000314:394297 T T_C
PH01SNP02050150 PH01000314:394332 C C_A
PH01SNP02050160 PH01000314:394357 A A_G
PH01SNP02050170 PH01000314:394378 A A_C
PH01SNP02050180 PH01000314:394394 G G_A
PH01SNP02050190 PH01000314:394475 A A_T
PH01SNP02050200 PH01000314:394486 A A_G
PH01SNP02050210 PH01000314:394528 A A_G
PH01SNP02050220 PH01000314:394603 T T_C
PH01SNP02050230 PH01000314:394757 G G_A
PH01SNP02050240 PH01000314:395141 A A_C
PH01SNP02050250 PH01000314:395239 T T_C
PH01SNP02050260 PH01000314:395267 C C_G
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_163621 4
Please click OG5_163621 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
(0 result)
Gene ID Short description Curator summary Computational description E-value
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os09g35790.2 HSF-type DNA-binding domain containing protein, expressed 3E-138
 
Function (determined by interpro in EMBL-EBI)
Protein family membership

None predicted.

Domains and repeats
1 50 100 150 200 250 300 350 382
Detailed signature matches
    1. SM00415 (HSF)
    2. PS00434 (HSF_DOMAIN)
    3. PF00447 (HSF_DNA-bind)
    4. PR00056 (HSFDOMAIN)
Unintegrated signatures no IPR
Unintegrated signatures
  1. PTHR10015 (HEAT SHO...)
  2. PTHR10015:SF7 (HEAT...)
  3. SSF46785 ("Winged h...)
GO term prediction

Biological Process

GO:0006355 regulation of transcription, DNA-dependent

Molecular Function

GO:0003700 sequence-specific DNA binding transcription factor activity
GO:0043565 sequence-specific DNA binding

Cellular Component

GO:0005634 nucleus

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
specific 215924 28 119 2.66E-55 pfam00447 HSF_DNA-bind cl12113 -
superfamily 245876 28 119 2.66E-55 cl12113 HSF_DNA-bind superfamily - -
non-specific 214654 26 118 1.32E-50 smart00415 HSF cl12113 -
multi-dom 227497 26 119 3.68E-29 COG5169 HSF1 - C
Conserved sites/feature
(0 result)
Type Brief name Coordinates Complete size Mapped size Source domain
 
DNA sequence
Upstream 1000 bp region from PH01000314G0470 gene.
ATGTCCTACATGTTTTCAATACCTTACTACCTTTCCGTAAAAAAGAAGACAACCTTACTACCTTCAAACAGTACATTTCAACTATGATTTTCACACTCGTAGGAAGGAAAATGTGAGATGTTTTTGCTAAATCTTGAAGAAAAATAACCCTAACAAACTCAGTTGCCGGGAAGCATCTCATACAGTTATACCTATAATACTCCCTCCGTTCTTTCTAGATGTCATTTTACAATACGTACAGTCAAATTTTCAAAATTTTGATGGCTAATATACATAAAATATATTTTGATTTTTCATGTGAAAATGATATTACTAGATTTGTAAAAAAACGTGTCATTATATTTTAAATAAGTTTTACTAATATATAATAAGAAAAATGTAAAAAAAAAGAATGGACACCCTAACAAAAAAAAAACATGGCACAAAAATAGATACCAAAAGTGTATTTATAGAACTAAATAGATTTGTTTAATTTTTACAACTAACAGGTGGACGCGCCCCGGCTACTTGTTAAATTAAGATATAAGTCGCCGTATTCAACGAGGCGGACAAAGCGCGTTCCGCGCCTTCTAGTGCCGATGACGTGTGTCGGTTGCTTGAGGCGCCAAACAAAATGCTGAGTCATCCCCCTCCGAATTGACAATTGACCCGTCGGAACACAAATTTTCTAAGCACAAAATCCGCTGTGGTTCACCGTGTACGAACCTGTCACATTTGGCTCATGATCACACGCGGTGGTAGACAAGACACGAGCAAATTTGGTGAGCACCCAATTCCAAGAACTACCCTTGCAAGTCGCAGTTCCTTCCATAGTTCTATTCTCAACCATTTCTACCAGCAAAGCTGCCTGTATACAACACCTAACACGCGCAAACCCACCAAAATTGCACAGCACATCAACAACGGAGATCGGTATAGAGCAAACAACCGAACAACATCTGGGAAATGCACTTCCCATTTGCATGCGCAACACACGCTACGCTGATAAATCAGGGGGTGCT
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGGCCGAGCAGGGAGCCGCCGCCGGCGAGCCTCTGGCTCTGGCAGAGGCGGAGGCGGCGGGGCAGAGGTCGCTGCCGACGCCGTTCCTGACGAAGACGTACCAGCTGGTGGACGACCCGGCGGTGGACGACGTGATCTCGTGGAACGAGGACGGGTCGACGTTCATCGTGTGGCGGCCGGCGGAGTTCGCTCGGGACCTCCTCCCCAAGTACTTCAAGCACAACAACTTCTCGAGCTTCGTGCGGCAGCTCAACACCTACGGATTTAGGAAGATCGTGCCGGATCGGTGGGAGTTCGCCAACGACTGCTTCCGGCGAGGGGAGAAGCGCCTGCTCCGCGACATACACCGCCGGAAGGTGGTGCCGCCGCCAGCGCCGTCGCCGGGGCTTGCAACGGCGGCTGCCGCGGCGGCGTCCGGGGCGGTTACGGTTGCCGCGGCGCCGATCCCGATGGCGCTGCCGGTGACGCGGCCGGGCTCGCCGGCGCACTCCGCCGAGGAGCAGGTGCTGTCGTCCAACTCCGGCTCCGGGGAGGAGCACCTGACGGCGCCGTCCGGCTCCGGCTCCGGCCTCGGCGGTGGCGGCGGGGGCTCCGCGTCCGGCGATCTGAGCGAGGAGAACTCGCGGCTGCGCCGGGAGAACTCGCGGCTGACCCGCGAGCTCGGGCAGATGAAGAAGCTCTGCAACAACATCCTCCTCCTCATGTCCAAGTACTCCGCCACCCAGCAGCCCGACGCCAACGCGGCGCTGTCCTCCGTCGCGAACTGCTCCGGCGAGTCCTCGGAGGCCCTGACCCCGCTGCCGTCGCTTCCCCCGGCGATACTGGACCTAATGCCCTCGTGCTCGGCGCTGGCCACCGCAGCCGTGGTCGCCGGTCTCGACGTCGACGGGGAGCCCGACACGAGCGCGAGGCTGTTCGGCGTCTCCATCGGGCTGAAGCGGACGCGAGACGATGGCGACGACGCCGGCGCGGGCGCCGCCGCCGACGAGGATCCGGCAGACGACCACGGCGCGGAGGTGAAACCGGAGCCGGCGGATCCGCGTGCCGACAGCAAGGAGCAGTCGCCGGACCAGCACCTGTGGCCCATATTTCGGCCCACTCCTGTGTACCGTGCCTGTAACGGACCGGACAGGGCCGGGTCCGAC
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01000314G0470 gene.
AACGGGAGAGAAGAAGAATAAAAAAGGCCACACAAAAGAAAACGTACTGTACTAATTCTACTGCGAAACACCACTCGTAGTCTCGTACCGAGAAAGCCAAGCGGGGCGCGGAGGTGGGCCCGGTCGTATGGATATCTCCTTGCAGCGCCGTCAGATCGGGATCTTGTGGGCGCGTACGGTCGGGATTCGCGATAGCGCAGGATATGGTTCTCTGCGGGGGGAGGATGGCGATGGGTGCGGTGGTAGGAAAGTGCGAGAAGGTTCTGTGGTTTTTTAACAGCTTCGGCTTTCTGGAAGGTTCAGGTAGGAGGGGATGGACAGGTGGATGGGACACGTGTCCACCGCTTGGCCACGGATAGCGAGTGGGATAAGATTTATACTTTGAATAATATATACTTTTGGTATTTGTGCTTTTTTTGTCAGCCTATTCGAAGGTTATTTCTTTTTTCGATCATTTTCCATGAGTAAATACTTATACATGTCATTAAAATTGTTCAATTCAGTACGAGTAATTATCTTTTCTACATCAAGTTCATGAAAGGTACTAGTATTAAGATTTCGGAGGAATCAACTTTGATGATTTGATTGTTTTTACTAGACAATTATCGAAGGATTGAAGTCTACGAACCGTACAAATACTGCTTCCGTTCCTAAATAGATGATATTATAGGATTTTGCACTTCAACTCACACACGTGTACAAAAAACTAAATTACCCTCTTTTATTAGGTCATTTATTGCTCTTGGATGTTGTGTATGACTCAGTCCATAGCAATAAATGATCTTGGAAATAGCCGAATAGGAGAGGTATATAAAGAAAATATCGTAAAAAGTCATCTCAAAATTGTATCTAGAAACAAAATTTGAAAGCTAGAATGACATTTATTTAGTAACAAGGGGAGTATCATATAAGGAGGGTGGCAACAGTGAGGAGATACCTACCACTTTAGAAAAGCTGGAGTTTCTACTTTCTACCACCCCTTCATATTTCTCCCATGAAGA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01000314 Download
Protein sequence
Protein sequence
MAEQGAAAGEPLALAEAEAAGQRSLPTPFLTKTYQLVDDPAVDDVISWNEDGSTFIVWRPAEFARDLLPKYFKHNNFSSFVRQLNTYGFRKIVPDRWEFANDCFRRGEKRLLRDIHRRKVVPPPAPSPGLATAAAAAASGAVTVAAAPIPMALPVTRPGSPAHSAEEQVLSSNSGSGEEHLTAPSGSGSGLGGGGGGSASGDLSEENSRLRRENSRLTRELGQMKKLCNNILLLMSKYSATQQPDANAALSSVANCSGESSEALTPLPSLPPAILDLMPSCSALATAAVVAGLDVDGEPDTSARLFGVSIGLKRTRDDGDDAGAGAAADEDPADDHGAEVKPEPADPRADSKEQSPDQHLWPIFRPTPVYRACNGPDRAGSD
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above