gene PH01000306G0790
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01000306:487491 - 491896(+ stand)   Name
Alternate name Locus tag PH01000306G0790
Length of gene 4406  bp Length of CDS 1344  bp
Product information
Feature type
CDS
Product name
COBRA-like protein precursor
Alternate name
Molecular weight
(predicted)
49586.0063200001  kDa
Isoeletric point
(predicted)
8.66820907592773
Length
447  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
(0 result)
SNP ID Position Base in Scaffold Polymorphism
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_139559 10
Please click OG5_139559 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
Gene ID Short description Curator summary Computational description E-value
AT5G15630.1
COBRA-like extracellular glycosyl-phosphatidyl inositol-anchored protein family
Encodes a member of the COBRA family, similar to phytochelatin synthetase. Involved in secondary cell wall biosynthesis. Mutants make smaller plants with reduced levels of cellulose and cell wall sugars.
IRREGULAR XYLEM 6 (IRX6); INVOLVED IN: secondary cell wall biogenesis; LOCATED IN: plasma membrane, anchored to membrane; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 12 growth stages; CONTAINS InterPro DOMAIN/s: Glycosyl-phosphatidyl inositol-anc
0
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os07g41320.1 COBRA-like protein precursor, putative, expressed 0
 
Function (determined by interpro in EMBL-EBI)
Protein family membership
Domains and repeats
None predicted.
Detailed signature matches
Unintegrated signatures no IPR
Unintegrated signatures
  1. PTHR31673 (FAMILY N...)
  2. PTHR31673:SF0 (SUBF...)
GO term prediction

Biological Process

None predicted.

Molecular Function

None predicted.

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
specific 218285 45 209 1.26E-99 pfam04833 COBRA cl04787 -
superfamily 218285 45 209 1.26E-99 cl04787 COBRA superfamily - -
Conserved sites/feature
(0 result)
Type Brief name Coordinates Complete size Mapped size Source domain
 
DNA sequence
Upstream 1000 bp region from PH01000306G0790 gene.
GGCCATTACATTCGTATTGTGCAATGTACTGGATTTGAAAAGCCTTAGCTCATGCCTCGGGCTGGCTTTCTAAAGCGGTTTTTTGAGTGAGGTAATAAGTGCTCCGTGCAAGGGTCTTGTCTGCGATTTGTCGTTCTGTTGTTGTTTGGTCGTTCATATAGAGATCGTTGCACGACGTGCTTGTCACAGGACATGAATATAACATGAAAATCGTGTGCATATATATGCACGGTTTCGTGAACTACTGGCCTGGACGATGGTAGTAGTTACCGGTGGTTTGGTACCGAGGTAGTGTCGAATTGTTAATTAGGTTGTAAAAGTGTAAAACTATATACCGATGTGCACATTTGCTACTGCTCTTGTGCACTGCCATCGTGCCGTGTAAGCGAGTGCTTGGCTGTCCTAAACTGACAGCGTAGTTTGAACAAACCACGGTTCAAGATTCTGGAGTGCCCTGGTTGAGTAAGATGAATTGGATGACCAAGATCACAACACATTTCAACATGGAAACCAGAACATCTTTTGTACGTTAGAACTTTCTAGCAAGGATAAAAACGCTGAACCCACCAAAGCAACCTAAATGTTCTTCAAAGTCAATCTATATAGCACAAATTAACCCTGTAGTTTGACCTGGATGGAGAACACCTTTCGTTTTTTTTTTCGGACGGAAATTTGACAAGGACATGTTTTTGCAGAGAAATCAAACTCAGAATTTGTCATTGCGGTGGCATGAATCGCCAACATCCATGTCCCAGTCCCAAAACTGTCAGATAGGACGTCCTAGGCTCTGACCAAAAGAACATGGACCATTTGCCCATGAGCCAACGACTAACCTGAAAGTCCAAGGATCGATCAATCAAATTTGTTCATCGGGTCAACTAGTTGGTAGTCATAAAACCGGTAATACACCTGGTATCTGTGAGTGTTCATGAATCCACTACTAATTGGTAGTCCTACTAGTAATTGGCCGATATTTATCTTAGAGATTGTTACGATGCTTT
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGGAGCTGCCCAACTCCGTGCTCGTCCTGATCTTTGCAGCCGCGCTCTCCGTTGCAGTGGCATATGACCCGCTTGATCCGAACGGAAACATTACCATCAAATGGGACGTCATGTCGTGGACACCTGATGGATATGTCGCGATGGTGACGATCAACAACTACCAGATGTACCGGCACATCATGGCGCCGGGGTGGACTGTGGGGTGGACGTGGGCGAAGCAGGAGGTAATCTGGTCCATGGTGGGGGCGCAGGCGACGGAGCAGGGCGACTGCTCCCGGTTCAAGGGCAACATCCCGCACAGCTGCAAGAGGACGCCGGCCGTCGTGGACCTGCTCCCCGGCGTGCCCTACAACCAGCAGATCGCTAACTGCTGCAAGGGCGGCGTCATCTCCGCCTACGGCCAGGACCCCGCCGCCGCCGTCGCCGCCTTCCAGGTCAGCGTCGGCCAGGCCGGCACCACCAACCGCACCGTCAAGCTCCCCAAGAATTTCACTCTCCTCGGCCCCGGCCCCGGCTACACCTGCGGCCGCGCCAAGATCGTCCCCCCCACCGTCTTCTTCACCCCCGACCACCGCCGCAAGACCCAAGCCCTTATGACGTGGAACTTGACGTGCACGTACTCGCAGCACCTGGCGTCCAAGTACCCGTCGTGCTGCGTCTCCTTCTCCTCCTTCTACAACGACACCATCATCCCCTGCGCCAAGTGCGCGTGCGGCTGCGAGCACAAGAGCTGCGTCCAGAGCGAGAGGGACTCGAAGCGGCTGGCGGTGTCGGGGAAGCACGAGCACGCGCACGCGCGAGGGCACAGGGGGGAGCGGGAGAGCGCGGCGCCGCTGCTGCAGTGCACGACGCACATGTGCCCCGTGCGCGTGCACTGGCACGTCAAGCACAACTACAAGGAGTACTGGCGCGCCAAGATCGCCATCATCAACTTCAACTACCGCATGAACTACACCGGCTGGACGCTCGTCGCCCAGCACCCCAACCTCGACAACATCACCGAGGTCTTCAGCTTCGACTACAAGCCCGTCGTCGCATACGGCTCCATCAATGACACTGCGATGTTCTACGGGCTCAAGTACTTCAACGACCAGCTGATGGAGGCGGGGCCGTACGGGAACGTGCAGTCCGAGGTGCTGATGCGCAAGGACGCCAGCACCTTCACGTTTAAGCAGGGGTGGGCGTTCCCGCGAAAGGTCTACTTCAACGGCGACGAGTGCCAGATGCCGCCGCCGGACTCGTACCCCTACCTGCCCAACTCTGCGCCGGTGGCCGCCTCAGCGTCGCTGATGAGCTCTGCAGTGGCGGCTGTCGTGGCTTTCTCGGTGCTGCTCATGGAATAA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01000306G0790 gene.
ATAAAGACCAAATAAAATCCAAATGAACTTCAAAACAAACCGAACTAGAACCAACAACAAGGGAGGTCCTGAGAAGGTGGTCCCGAGGAGAAGGTCATGAGGAGATCCTGAGGAGGTCCAAAGGAGGATATGACTACTCAACATGATCGTAGGAATGATACAAAAGGATACGATTATGCAACGTAGTCGTAGGGACAAGGGAAGAGAACAAGGCACGGAGAAACTCACTAGGGCCGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGACTGAAGAAGGAGGGGAAGAGAGCAAGAGAGCTGGGTGTGAAAAAAAAGGTAATGAAAGAGGGCTGCTCAGGCTTTTATAGCCAGGGGAGACGAGGAGAGTCACTGAAAGACTCAAAGGCCCACACGATCAATGGTAGGTGAAGGAGGAGATGGGGGCAGGTAGGGGAGGAGACAAGAGGGGGAACGAGTACTACAGAAGCAATATCATTTAATGCGACACAACAGCATTTAATGCGCACAGACAAATGTGTCAGTAGTGACGCAGCGGGAGGAAGAAGAAGGTGAGCAGGGCTGACAGGTGGGGATAGTCAAAACTCAGGAGGGTGATCAAACCAAAGGGGAGGTCGTGACCAAAGGGGAGGTCTTCTAAGACCACCTGGAGATATCTTCGGACCACCCAGGAGATCTTCCAAGACCACCCGGAAGTCTCTCAGGACCACCCAGGAGGTCTTCCAAGACCACTCGGAGGTCTGGACCGAGGGGGAGGTCCAAACGAGAGGGAGGTCTGGACAGAGGGGGAGGTCCAAACGAGAGGGAGGTCTAGACCGAGGGGGAGGTCCAAACGAGAGGGAGGTCTGGACAGAGAGAGAGAGGTCCAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01000306 Download
Protein sequence
Protein sequence
MELPNSVLVLIFAAALSVAVAYDPLDPNGNITIKWDVMSWTPDGYVAMVTINNYQMYRHIMAPGWTVGWTWAKQEVIWSMVGAQATEQGDCSRFKGNIPHSCKRTPAVVDLLPGVPYNQQIANCCKGGVISAYGQDPAAAVAAFQVSVGQAGTTNRTVKLPKNFTLLGPGPGYTCGRAKIVPPTVFFTPDHRRKTQALMTWNLTCTYSQHLASKYPSCCVSFSSFYNDTIIPCAKCACGCEHKSCVQSERDSKRLAVSGKHEHAHARGHRGERESAAPLLQCTTHMCPVRVHWHVKHNYKEYWRAKIAIINFNYRMNYTGWTLVAQHPNLDNITEVFSFDYKPVVAYGSINDTAMFYGLKYFNDQLMEAGPYGNVQSEVLMRKDASTFTFKQGWAFPRKVYFNGDECQMPPPDSYPYLPNSAPVAASASLMSSAVAAVVAFSVLLME
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above