gene PH01000305G0690
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01000305:459895 - 466316(- stand)   Name
Alternate name Locus tag PH01000305G0690
Length of gene 6422  bp Length of CDS 1908  bp
Product information
Feature type
CDS
Product name
auxin response factor 18
Alternate name
Molecular weight
(predicted)
69465.4783200002  kDa
Isoeletric point
(predicted)
7.24580001831054
Length
635  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
SNP ID Position Base in Scaffold Polymorphism
PH01SNP02000090 PH01000305:465542 G G_A
PH01SNP02000100 PH01000305:465557 C C_T
PH01SNP02000110 PH01000305:465646 A A_G
PH01SNP02000120 PH01000305:465924 G G_T
PH01SNP02000130 PH01000305:465988 C C_T
PH02SNP00011170 PH01000305:461607 G G->A
PH02SNP00011180 PH01000305:461608 C C->T
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_150287 8
Please click OG5_150287 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
Gene ID Short description Curator summary Computational description E-value
AT4G30080.1
auxin response factor 16
Involved in root cap cell differentiation. Gene expression is regulated by mir160.Located in the nucleus.
auxin response factor 16 (ARF16); CONTAINS InterPro DOMAIN/s: Aux/IAA-ARF-dimerisation (InterPro:IPR011525), Transcriptional factor B3 (InterPro:IPR003340), AUX/IAA protein (InterPro:IPR003311), Auxin response factor (InterPro:IPR010525); BEST Arabidopsis
0
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os10g33940.1 auxin response factor 18, putative, expressed 0
 
Function (determined by interpro in EMBL-EBI)
Protein family membership
Domains and repeats
  1. Domain
1 100 200 300 400 500 635
Detailed signature matches
    1. PF02309 (AUX_IAA)
    1. SSF101936 (DNA-bind...)
    1. PF06507 (Auxin_resp)
    1. PS50962 (IAA_ARF)
Unintegrated signatures no IPR
Unintegrated signatures
  1. PTHR31384 (FAMILY N...)
GO term prediction

Biological Process

GO:0006355 regulation of transcription, DNA-dependent
GO:0009725 response to hormone stimulus

Molecular Function

GO:0003677 DNA binding
GO:0046983 protein dimerization activity

Cellular Component

GO:0005634 nucleus

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
specific 197383 68 169 5.17E-20 cd10017 B3_DNA cl15242 -
superfamily 246903 68 169 5.17E-20 cl15242 BfiI_C_EcoRII_N_B3 superfamily - -
specific 191545 227 309 7.55E-44 pfam06507 Auxin_resp cl05824 -
superfamily 191545 227 309 7.55E-44 cl05824 Auxin_resp superfamily - -
non-specific 216995 69 170 1.75E-27 pfam02362 B3 cl15242 -
non-specific 214977 69 170 8.66E-24 smart01019 B3 cl15242 -
non-specific 216968 544 615 1.67E-05 pfam02309 AUX_IAA cl03528 N
superfamily 216968 544 615 1.67E-05 cl03528 AUX_IAA superfamily - N
non-specific 197381 69 157 0.000145465 cd10015 BfiI_C_EcoRII_N_B3 cl15242 -
Conserved sites/feature
Type Brief name Coordinates Complete size Mapped size Source domain
specific putative DNA binding site K71,T74,G82,S85,P87,R122,L133,T135,T136,W138,S139 11 11 197383
 
DNA sequence
Upstream 1000 bp region from PH01000305G0690 gene.
GCTGTCTAAGATCGATGAAGAAATCAAGAGTGATTTAGTTGTGGTTAGCAAGAAGAATGCCGTGAAGACTACACTAAACCGATGACGGTTTTGCTTCAAGAAGAGTAGGATGATGAGGCCCTATGTGCATCTACTACGGTGGCAAATATCCCTAAGTTGGAAGTTTGAGTTGAAGAAAATACAGAAAAGTCATATGTTTATGTAGTGCATAATAAGTACATGTTTTTCGAAAATTCTCATCCAGTGTTTTGTGATTGCGTGAATATTGGAGGGTCACTTTTCTTCCAAGATCCGTGATTCCTTGTGGATCATCTAACCAATTCATGGCATCCTCAATTGCTCACGGTTTGGTGTTGTTCTTTGAGTTTGATTTTGCTTATCTCTTCGGATTGATTCAACATCAACCAGTTATCATTATTTGCTTTGGAGATACGCTTGTTCTATATTTTTGCCGAACCAAGAAGGAGAAAAGCTAGTATTTTGTTTCGATCAAGATTGAAATTCAAGTACCAAGAAAGATTGGACCATATTACGCATCAATCACACGTTGATACGTATCATATGTTGCATTTTCTTTTAAGAAAGAAATAATAGCATTTGTTCTATGCACAGTAGTCTTTAACTGCACTTCTCAACTAACGCGCAAGCGTCTATCCCCAATTACCAAACGAAAAACAAAATTTTAATGTGAAAATTCCTCCAATTTTAGAGCACGGTATTGCAACTTCAAACTGACATTGGATGATTTCTCAATGAATCTTTAAAGAAATCATGAAACTTATAAATGCCTGATACGCCTTGGTTCTCATGCTAACGAATTGAACAAAGCAGCTGTAGAGAAAAGCGGATACAAGATTTAATGTGCTCTGACTGAAGCAACACCTTCAATTCTCTGTTCTTATCTAAACGAAAAATGGAGACATCGAATGCACTAATTCATGTCCATTTCAAACATTGCATTTCCCTTTTACTAGCTTTATTTTCCTTTAACAAACTGAAAC
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGGCGGCCGGGCCGCGCGCGCTCCCCGCGCTGGTGCTCTGCTGCGTGGCAGGGGTGCGGTTCTTGGCTGATCCGGAGACTGACGAGGTGTACGCCAAGATCCGGCTGGTGCCGGTTGGCCCCGGCGAGGTGGAGTTCCGGGAGCCGGAGGAGCTTGGCCCGCTCGGGGACGACCCCGCGGAGGCGCGGGAGAAGCTGGCCTCCTTCGCCAAGACACTGACGCAGTCCGACGCCAACAACGGCGGCGGGTTCTCGGTGCCGCGCTACTGCGCGGAGACCATCTTCCCCAAGCTGGACTACAGGGCCGACCCGCCGGTGCAAACGGTGCTCGTCAAGGACGTCCACGGGGAGGTGTGGAAATTCCGGCACATCTACCGGGGCACGCCGCGCCGGCATTTGCTCACCACGGGGTGGAGCACGTTCGTGAACCAGAAAAAGCTCGTCGCGGGGGACTCGATCGTGTTCCTGCGCACTGAGCATGGGGAGCTCTGCGTCGGGATACGGCGGGCGAAGCGGGTGGCCTGCGGGGGCATGGAGTGCATGTCCGGGTGGAACGCTCCGGGGTATGGGGGCTTCTCGGCGTTCTTGAAGGACGAGGAGAACAAGTTCATGAAGGGCCCCGGTGGGTACGTGAGGAGGGGCAGGGGAAAGGTGAAGATTGCGGATGTCGTGGAGAAGGCCAGCCTTGCGGCGAACGGGCAACCATTTGAGGTGGTGTACTACCCGAGAGCTAGCACACCAGAGTTTGTTGTGAAGGCTGCATCGGTGCAGGTTGCGATGAGGATCCAGTGGTGCCCCGGGATGAGGTTCAAGATGGCGTTTGAGACAGAGGATTCCTCAAGGATTAGCTGGTTTATGGGGACGATTTCTTCTGTTCAGGTTGCTGATCCAGTCAGATGGCCAAATTCACCGTGGAGGCTTCTTCAGGTATCATGGGATGAACCAGACTTGTTGCAGAATGTGAAATGTGTCAGCCCATGGCTTGTGGAGCTTGTATCAAGCATTCCGCCAATCCATTTGGGGCCATTTCCTCCACCACGAAAGAAGTTGCGGATGCCCCAGCATCCCGACTTCCCATTTGATGGTCATCTGTTGAATCCAATTTTCCACGGAAATCCACTTGGTCCTAGCAACAGCCCCCTATGCTGTTACCCGGACAATGCTCCTGCAGGCATACAGGGAGCCAGGCATGCTCAATTTGGTTTACCCTTAACAGATCACCAGCTTAATAAGCTGCACCTTGGTCTGTTCCAAGGCAGCGGTTTTAACCGGCTTGATGCTATCACTCCATCTTCCCGGATATCTAAGGGCTTTGTGATCAGTAGCACACCAGCCCATGACAGCGTCTCTTGCTTGTTGACAATCGGTACACCACAGGGCACAGAAAAATCTGATGACAGAAAGACGCCCCACATAATGCTGTTTGGAAAGGCTATTTTGACGGAGCAACAGATAACTTCAAGTGGATCAAGGGAGACATTCTCCCCTGGGATTACTGGAAATAGTTCACCTAATGGCAATGAGAAGAAGGCAGGAAACGCATCTGATGGTTCTGGTTCATCAATTTGCATTGGTTTCTCATCCCAAGGTCATGAGGCTTCTGACCTTGGATTAGAAGCTGGGCACTGCAAGGTATTTATGGAATCAGAGGATGTTGGTCGCACCATAGACTTGTCTGTTTTCGGGTCATATGAAGAACTGTATGGTCAGCTGGCTGACATGTTTGGAATCGAGAACGAAGAAATAGTAAGTCATCTTCGTTACCGTGATGCAGCTGGTGTAGTCAAGCATACTGGTGAAGTACCATTCAGTGACTTCATGAAAGTAGCACGGAGACTTACAATAATAGCCGGCGACAGGGGGAGACTGCAGAAACCTCTCATCGAGTGTATGGTTGAGCGGGTGTGA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01000305G0690 gene.
GCTCATACAATGGGTTGTCTTTTCACTTGTCTTTATAGATAACACAATCTTTTAATGCTTTCATGGACCTAAGACATTTCCTCCTTTGCTCTGGTGATACAGTCGGCTACAGGATTGTAAATAATATATTTCTCTCTCTTTATTCCCTTTCATCCACATCAACTTAAATTCTACGTAACAGAGACTATAGACAGCTAATATAAACCCATTATATATGACCTTACGAGTTGGGAGGTGCTTCTATGCTTCACCCCTTGAGGGTTGCACAATGAAGATGGAGGAAAATGCCGTGCTGCGCATGTGTTTAAAGCTCGTTCCAGTACACAATTACGACGAACGGATGCAATGTTCAACGATACCAACCGGGTTAATCCTTCTGAGCAAACGAGGAAGCCGGTACGGTGTGAGCATTAGGTTGGCGGGGTTTCTTCACGAAACAAGGCCACTCACATTTAACGCATGAATCTACTGTGTGCAGGAGAGGCCAACGCTGAAGTCATTTGACCTTGAAAAAACTCGGTGATTTGTGACGTAAGTAGTTAAGTACTCATCTAATCCGACCTCATCGTTAACCACGTCAAAATTGCTTTTGTTTTTTGTTTCTCTGATGTTGCCGTTGGATCCAAGTGCGCAAGCGCCGACGTGCCGAGCCACCGCACACCGAGGCCGCTCGCGCCACCGGTCGACCGCCTGAAAAGTCGTCTTCTAGCAGACGCATCTCTCCCATCACGTTTACTGCAAGTGTTTGATCATCTCTAATGTATTGTTTTAGCCTGTTCAAAGGAGATAGAAGATATTAAATCAATTCAATATATTGGAGAGGTCGATTTCGACAAATTTTTCTTCTGAAATCGGGCTCTACATAAGAGTCGATTCAAAGCATTGATGAGCCAAGTTATGAAAGAGAGAGAGAGTACAGTTGAAAGAGGATATTATTTTTGTGGTTTTTTTAATGTAACGTGGGTTCCGGTTATTAGTAGGATTAGATCAATACATTGGAG
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01000305 Download
Protein sequence
Protein sequence
MAAGPRALPALVLCCVAGVRFLADPETDEVYAKIRLVPVGPGEVEFREPEELGPLGDDPAEAREKLASFAKTLTQSDANNGGGFSVPRYCAETIFPKLDYRADPPVQTVLVKDVHGEVWKFRHIYRGTPRRHLLTTGWSTFVNQKKLVAGDSIVFLRTEHGELCVGIRRAKRVACGGMECMSGWNAPGYGGFSAFLKDEENKFMKGPGGYVRRGRGKVKIADVVEKASLAANGQPFEVVYYPRASTPEFVVKAASVQVAMRIQWCPGMRFKMAFETEDSSRISWFMGTISSVQVADPVRWPNSPWRLLQVSWDEPDLLQNVKCVSPWLVELVSSIPPIHLGPFPPPRKKLRMPQHPDFPFDGHLLNPIFHGNPLGPSNSPLCCYPDNAPAGIQGARHAQFGLPLTDHQLNKLHLGLFQGSGFNRLDAITPSSRISKGFVISSTPAHDSVSCLLTIGTPQGTEKSDDRKTPHIMLFGKAILTEQQITSSGSRETFSPGITGNSSPNGNEKKAGNASDGSGSSICIGFSSQGHEASDLGLEAGHCKVFMESEDVGRTIDLSVFGSYEELYGQLADMFGIENEEIVSHLRYRDAAGVVKHTGEVPFSDFMKVARRLTIIAGDRGRLQKPLIECMVERV
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above