gene PH01000305G0590
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01000305:388998 - 397256(- stand)   Name
Alternate name Locus tag PH01000305G0590
Length of gene 8259  bp Length of CDS 2553  bp
Product information
Feature type
CDS
Product name
START domain containing protein
Alternate name
Molecular weight
(predicted)
93518.3204200002  kDa
Isoeletric point
(predicted)
5.71369552612304
Length
850  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
SNP ID Position Base in Scaffold Polymorphism
PH01SNP01999690 PH01000305:393169 C C_T
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_137066 9
Please click OG5_137066 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
Gene ID Short description Curator summary Computational description E-value
AT5G60690.1
Homeobox-leucine zipper family protein / lipid-binding START domain-containing protein
REVOLUTA regulates meristem initiation at lateral positions. a member of a small homeodomain-leucine zipper family. Has overlapping functions with PHAVOLUTA and PHABULOSA.
REVOLUTA (REV); CONTAINS InterPro DOMAIN/s: Homeobox (InterPro:IPR001356), Homeodomain-like (InterPro:IPR009057), Lipid-binding START (InterPro:IPR002913), MEKHLA (InterPro:IPR013978), Homeodomain-related (InterPro:IPR012287); BEST Arabidopsis thaliana pr
0
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os10g33960.2 START domain containing protein, expressed 0
 
Function (determined by interpro in EMBL-EBI)
Protein family membership

None predicted.

Domains and repeats
  1. Domain
  2. Domain
1 100 200 300 400 500 600 700 800 850
Detailed signature matches
    1. SSF46689 (Homeodoma...)
    1. PS50071 (HOMEOBOX_2)
    2. PF00046 (Homeobox)
    3. SM00389 (HOX)
    1. SM00234 (START)
    2. PS50848 (START)
    3. PF01852 (START)
    1. PF08670 (MEKHLA)
Unintegrated signatures no IPR
Unintegrated signatures
  1. PTHR24326 (FAMILY N...)
  2. SSF55961 (Bet v1-like)
GO term prediction

Biological Process

GO:0006355 regulation of transcription, DNA-dependent

Molecular Function

GO:0003677 DNA binding
GO:0003700 sequence-specific DNA binding transcription factor activity
GO:0043565 sequence-specific DNA binding

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
specific 176884 157 373 9.16E-73 cd08875 START_ArGLABRA2_like cl14643 -
superfamily 246681 157 373 9.16E-73 cl14643 SRPBCC superfamily - -
specific 238039 26 86 3.25E-16 cd00086 homeodomain cl00084 -
superfamily 241599 26 86 3.25E-16 cl00084 homeodomain superfamily - -
non-specific 216740 162 367 2.09E-47 pfam01852 START cl14643 -
non-specific 214575 163 367 1.77E-33 smart00234 START cl14643 -
non-specific 200956 26 84 1.39E-16 pfam00046 Homeobox cl00084 -
non-specific 197696 26 83 2.02E-15 smart00389 HOX cl00084 -
non-specific 176851 200 347 3.37E-12 cd00177 START cl14643 -
specific 197664 78 130 7.76E-06 smart00338 BRLZ cl02576 N
superfamily 243100 78 130 7.76E-06 cl02576 B_zip1 superfamily - N
non-specific 201054 78 123 0.000315084 pfam00170 bZIP_1 cl02576 N
multi-dom 219964 703 850 1.18E-74 pfam08670 MEKHLA - -
multi-dom 227863 6 111 2.87E-11 COG5576 COG5576 - N
Conserved sites/feature
Type Brief name Coordinates Complete size Mapped size Source domain
specific putative lipid binding site M185,P186,S194,A209,A211,I222,L226,P230,F233,R234,D235,C236,Q259,Y261,A262,P263,T264,V267,R270,F272,T274,E290,A311,M313,L314,P315,S316,Y318,V330,I332,D334,L336,L338,A340,R348,L350,Y351,E352,S354,R355,V356,Q359,K360,R367 44 44 176884
specific specific DNA base contacts K26,R29,V73,Q76,N77,C80 6 6 238039
specific DNA binding site K26,Y27,V28,Y30,K47,R53,Q70,K72,V73,Q76,N77,R79,C80,R81,K83,Q84 18 16 238039
 
DNA sequence
Upstream 1000 bp region from PH01000305G0590 gene.
CTTTTGTCTTCTGTGCTCCACCCTTAAATAACTTTCGAAGAGGTGGCCGTTACTCCTAGAGAAGATGTCCCTGGTGAAACGTCGCGACTGGTCGGAACGATGCGACAGTTGATAATGTATTAGCTGCTCTATGGTTGAGACACTCAACCGTATGGTGGTTGTCAGTGTCTTATGATTATGTAACGTCGAATGGTTTGAAATATACAGCACGTGTTCTATTCATCACGCGGTAAAGAATATACCTGGAGTCATATCCAGATACTAGTTCATAACTTTTCCGAGCAGCTATTTAGTCAGAGACTAGGCACGGGACCTTGTCCGACTGGGTACCCATTATGTAACCTCTGAAATCTTCACAACCAGTAAAATCGTTAGCCTTAGAGGTAACGATCATAAAGACGTGTGGTCTTTTATTATGTATTAAAGTAATACATAAATGTTTTAATTCTCGTCAGTAATGCTTCCGATTGTGAGTGAATCTCGTTAACTATGATTGGTTTGTTACACTGTAGTACTTTACATGTGATGTGATGAGGTGCTGATCTGTTGTGATCGTCCCTGCTGTTTGCATTAGCAACTTCCTCGGACCACCAAGACATGCTAAATTTTACAAAATCTATGATCTAACAAATCTGTCGCTCATGGCTCGTTACTCGTTCTCAATTCGAGACAATTTTGGTAAACATAGTATTTAACCGATACCATACCGTAATAAATTGAAATTCAATTCGAGACAATTTTGGTAAACATAGTATTTTACCGATATCATACCGAAATAAATTGAAATTCACTGATACCAAACCGTATTTTAACTAACAACGTATTTACCATATATATCATATTCACTGAACCATATTTACCAAAAATACCGAACAAACATCCCTACTAATGTTCCTAGGGTAAAGCTTTGCACTACCACAACCTGGATGCCTACCTTGATCATAACCGACAAACACAGACGAAAATTTTACGACAATGACACAAGGTATTCACAGGGCCAT
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGGCGGCGGCGGTGGCGATGCGGAGCGGGAGCGGGAGCGACGGCGGGTACGACAAGGCCGGGATAGACTCGGGCAAGTACGTGCGATACACGCCGGAGCAGGTGGAGGCGCTCGAGCGGATGTATGCTGAGTGCCCCAAGCCCAGCTCCACGCGCAGGCAGCAGCTGCTGCGTGAGTGCCCGATTCTGGCCAACATCGAGCCGAAGCAGATCAAGGTCTGGTTCCAGAACCGAAGGTGCCGTGATAAGCAGCGGAAGGAGGCCTCCCGGCTTCAGGCCGTGAACAGAAAATTGACCGCGATGAACAAGCTTCTCATGGAAGAGAATGATCGTCTCCAGAAGCAGGTTTCCCAACTTGTTCATGAGAATGCATACATGAAGCAGCAGCTGCAGAATCCATCATTGGCCAATGATACAAGCTGTGAATCAAATGTGACCACTCAAAACCCTCTGAAGGATGCAAGTAACCCTTCTGGACTCCTTTCAATTGCGGAGGAGACCTTGACAGAGTTCCTCTCAAAGGCTACAGGGACTGCTGTCGATTGGGTCCAGATGCCTGGGATGAAGCCTGGTCCGGATTCGTATGGTATTGTGGCCATTTCACATGGTTGCCGTGGTGTTGCTGCCCGTGCCTGTGGTTTGGTGAATCTAGAACCAACAAAGATTGTGGAGATCTTGAAAGACCGCCCATCTTGGTTCCGTGATTGTCGGAGTCTTGAAGTGTTTACAATGTTTCCAGCTGGAAATGGTGGGACTATTGAACTCATTAACATGCAGATGTATGCTCCTACTACTTTAGTTCCTGCACGAGATTTTTGGACACTGAGATACACAACGACAATGGAGGATGGCAGTCTTGTGGTCTGTGAGAGATCCTTGAGTGGTTCAGGAGGTGGTTCAAGTACCGCCTCAGCACAGCAATTTGTAAGAGCTGAGATGCTTCCTAGTGGCTATTTAGTTCGGCCATGCGAGGGTGGGGGCTCAATTGTGCATATAGTGGACCATCTGGACCTGGAGGCTTGGAGTGTTCCTGAAGTGCTTCGGCCGCTCTATGAGTCGTCTAGGGTAGTTGCCCAGAAAATGACTACAGCGTTCCTACGTTCCATACTGACTATTCTTGTTATCAAGGCGCTACGGCACATCAGACAAATTGCTCAAGAAACTAGTGGGGAGGTTGTATATGCTTTGGGGAGGCAGCCTGCCGTTCTACGGACATTTAGTCAGAGGTTGAGTAGAGGATTTAACGATGCTATAAGTGGTTTCAATGATGATGGTTGGTCTGTCATGGGTGGAGATGGCATTGAAGATGTAATCATTGCTTGCAACTCAAAGAAGATTAGGAACAATAGCACTGCTGCCAATGCTTTTGGAGCCCCTGGAGGCGTTATATGTGCTAAGGCATCCATGTTACTGCAGAGTGTTCCACCAGCAGTACTGGTTCGGTTTCTGAGGGAACATCGGTCTGAATGGGCTGATTATAACTTCGATGCATATTCGGCTTTAGCACTGAAGACGAGCTCATGTTCACTTCCTGGGTTGCGGCCTATGAGATTTTCTGGGAGCCAGATCATCATGCCACTTGCTCACACAGTGGAGAATGAGGAGATTCTAGAAGTCGTTCGTCTTGAAGGGCAGGCACTTACACATGATGAAGGTCTTTTATCAAGAGATATCCACCTGCTTCAGCTTTGCACTGGAATAGATGAGAAATCAATGGGATCCTGCTTCCAGCTTGTCTTTGCACCCATCGATGAGCTTTTCCCTGATGATGCCCCATTGATATCTTCAGGCTTTCGTGTTATACCACTGGACATGAAAACAGATGGTGCACCTACTGGTAGAACATTAGATTTGGCCTCTAGCCTTGAAGTTGGTTCAACTACACAACAAGCTACAGGGGATGCATCTCTGGATGATTGTAGGAATCTGCGATCAGTGCTGACAATTGCCTTTCAATTCCCTTATGAAATTCATCTCCAGGATAGTGTTGCAACTATGGCCCGGCAATACGTCCGTAGCGTTGTTTCTGCTGTGCAGAGAGTGTCGATGGCTATTTCTCCCCCTCGATCTGGTGTGAATGCTGGGCAGAAGATATTTTCTGGCTTCCCTGAAGCCGCAACACTTGCTTGCTGGATTTGCCAAAGCTACCAGTTCCATTTGGGAGTGGAGTTACTTAGGCAGGCAGATGAAGCTGGGGAATCATTATTGAGAATGCTCTGGGATTACGAAGATGCTATCTTGTGCTGTTCTTTCAAGGAAAAGCCTGTATTTACTTTTGCCAACGAGATGGGACTTAACATGTTAGAAACATCTCTCGTTGCTCTACAAGACCTCTCATTGGACAAGATATTTGATGAAGCTGGTAGAAAGGCACTATATTCGGAGATCCCAAAATTGATGGAACAGGGCTATGTTTACCTGCCGGCTGGTGTGTGCTTGTCCGGAATGGGCCGCCATGTCTCTTTCGAGCAAGCTGTAGCATGGAAAGTACTTGGTGAGGACAACAATGTGCACTGCCTGGCCTTCTGCTTCGTCAACTGGTCTTTCGTGTGA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01000305G0590 gene.
GAAAATGGTTCTGTCATATTTGTTTTTATATTTTTTTTCACATACGGATACGAATACGGATGCAAATAATATCGAATACGGAGCGAATACGAATCGAACGAATACGATCACAAATATTTTTTCGGAACATGAAAACCCCTTAAATTACATGTCATTTAATCGTACGCGGCTTATACATATGTTTGATACTTTGGTCCAATAATTACACAGTGTTGGTATTTATTAATACTGGTGCTTATTCTACTACTAGATCTATTACGATTAATCTTTACTAAAATTTACCTAATTGCCTAATTTTTCATTTCTTCCCTAATTTTTTTTCCTAATTTCTTTCTTAATCTCTCTCCTTTTCCCCCTAATCTCTTTTCTCTCTCCACCATATCCTTTCCAACTGAATTCTTCTTCCTCATCTTTCTTTTCCCCCATTCTTCTCACTTCCGCCGCCGCAGCAATCGGCTCCTCCTCCCCGAGCTGCCCTTCCCCAACTGCGAGCTCACCCTCAGCAGCTACCTCTGCGACAAGTCGGGGCCCCCTCACCTCTGCCGCCGCAGCAGTCGGCCCCTCCTCCCCTCCTAACCCTGCCGCACTCGCCGCCGCCGCCAAGCTCTGCGTCAAGCGCAACTTCCTCCACCTCTCCACCCCCAAGTGCGGGGAGCCCCCCGGCGATGACTCCTCCGTCGTCGGAGGGAAGAAGGCCCGCCTCGACTCCCTTCAGCTCTCTCTCTCCCTCCCCTCCAACGCGCCCGCACCGCCGTCCTCCCAGCCGCAGCTCGCGTCCCTCCTCCCGACCGCCCCTCCAGCCGATGGAGATCTCCGGACCGGAGCCGCAGCGAGGCGAGGGCGACCTGAAGCCGTGACGGTGCAGGGGAGCCCGCGGGGGACAAGCGATGTGGCCGGCGAAGGCAGGCGAGGTGGCCGACGAAGGCGCAACCGCGCAGGGGAGCCCGCGGGGGACGGGCGATGTGGCCGGCGGCGAGGCGAGGACGGCTTGAAGCTGTGAC
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01000305 Download
Protein sequence
Protein sequence
MAAAVAMRSGSGSDGGYDKAGIDSGKYVRYTPEQVEALERMYAECPKPSSTRRQQLLRECPILANIEPKQIKVWFQNRRCRDKQRKEASRLQAVNRKLTAMNKLLMEENDRLQKQVSQLVHENAYMKQQLQNPSLANDTSCESNVTTQNPLKDASNPSGLLSIAEETLTEFLSKATGTAVDWVQMPGMKPGPDSYGIVAISHGCRGVAARACGLVNLEPTKIVEILKDRPSWFRDCRSLEVFTMFPAGNGGTIELINMQMYAPTTLVPARDFWTLRYTTTMEDGSLVVCERSLSGSGGGSSTASAQQFVRAEMLPSGYLVRPCEGGGSIVHIVDHLDLEAWSVPEVLRPLYESSRVVAQKMTTAFLRSILTILVIKALRHIRQIAQETSGEVVYALGRQPAVLRTFSQRLSRGFNDAISGFNDDGWSVMGGDGIEDVIIACNSKKIRNNSTAANAFGAPGGVICAKASMLLQSVPPAVLVRFLREHRSEWADYNFDAYSALALKTSSCSLPGLRPMRFSGSQIIMPLAHTVENEEILEVVRLEGQALTHDEGLLSRDIHLLQLCTGIDEKSMGSCFQLVFAPIDELFPDDAPLISSGFRVIPLDMKTDGAPTGRTLDLASSLEVGSTTQQATGDASLDDCRNLRSVLTIAFQFPYEIHLQDSVATMARQYVRSVVSAVQRVSMAISPPRSGVNAGQKIFSGFPEAATLACWICQSYQFHLGVELLRQADEAGESLLRMLWDYEDAILCCSFKEKPVFTFANEMGLNMLETSLVALQDLSLDKIFDEAGRKALYSEIPKLMEQGYVYLPAGVCLSGMGRHVSFEQAVAWKVLGEDNNVHCLAFCFVNWSFV
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above