gene PH01000300G0800
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01000300:509034 - 512056(+ stand)   Name
Alternate name Locus tag PH01000300G0800
Length of gene 3023  bp Length of CDS 1371  bp
Product information
Feature type
CDS
Product name
OsFBK15 - F-box domain and kelch repeat containing protein
Alternate name
Molecular weight
(predicted)
51361.7041200001  kDa
Isoeletric point
(predicted)
6.74223709106445
Length
456  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
(0 result)
SNP ID Position Base in Scaffold Polymorphism
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_190750 2
Please click OG5_190750 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
Gene ID Short description Curator summary Computational description E-value
AT5G60570.1
Galactose oxidase/kelch repeat superfamily protein
Galactose oxidase/kelch repeat superfamily protein; CONTAINS InterPro DOMAIN/s: Galactose oxidase/kelch, beta-propeller (InterPro:IPR011043), Kelch repeat type 1 (InterPro:IPR006652), Kelch related (InterPro:IPR013089), Kelch-type beta propeller (InterPro
5E-156
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os04g52830.1 OsFBK15 - F-box domain and kelch repeat containing protein, expressed 0
 
Function (determined by interpro in EMBL-EBI)
Protein family membership

None predicted.

Domains and repeats
  1. Domain
  2. Repeat
1 50 100 150 200 250 300 350 400 456
Detailed signature matches
    1. PF01344 (Kelch_1)
    2. SM00612 (Kelch)
Unintegrated signatures no IPR
Unintegrated signatures
  1. PTHR24413 (FAMILY N...)
  2. SSF117281 (Kelch motif)
GO term prediction

Biological Process

None predicted.

Molecular Function

GO:0005515 protein binding

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
specific 201739 244 290 3.09E-06 pfam01344 Kelch_1 cl02701 -
superfamily 243146 244 290 3.09E-06 cl02701 Kelch_3 superfamily - -
non-specific 128874 258 303 0.000480769 smart00612 Kelch cl02701 -
non-specific 201739 292 337 0.00124623 pfam01344 Kelch_1 cl02701 -
superfamily 243146 292 337 0.00124623 cl02701 Kelch_3 superfamily - -
non-specific 206134 244 293 0.00429634 pfam13964 Kelch_6 cl02701 -
non-specific 222113 254 300 0.00845317 pfam13415 Kelch_3 cl02701 -
multi-dom 205596 244 289 0.00100071 pfam13418 Kelch_4 - -
multi-dom 222983 179 385 3.47E-15 PHA03098 PHA03098 - N
multi-dom 222983 245 387 8.91E-13 PHA03098 PHA03098 - NC
multi-dom 177814 200 414 5.03E-05 PLN02153 PLN02153 - NC
multi-dom 211835 284 410 0.000341473 TIGR03548 mutarot_permut - NC
multi-dom 222983 178 284 0.000696581 PHA03098 PHA03098 - N
multi-dom 237617 272 410 0.00153336 PRK14131 PRK14131 - C
multi-dom 165153 240 359 0.00273895 PHA02790 PHA02790 - NC
multi-dom 211835 250 410 0.00793322 TIGR03548 mutarot_permut - N
Conserved sites/feature
(0 result)
Type Brief name Coordinates Complete size Mapped size Source domain
 
DNA sequence
Upstream 1000 bp region from PH01000300G0800 gene.
CCTTATCCACATCTGACAGCATGGCACCTGATTAAACAAATGCCATGGAATAAAATGCAAAGGTTAGTCGCTAACGTATCGCTTCTCTCACTAATAAAATACAGTTTTTTTTTCTAGAATTCAAAATAAAATGCAGCTATGTACTCCACTGCATCTCCCTGCAATCAAATCTACCTCCTGATCATGCATCCTCCATTTAAACCTTTGGTAACAAAAAATTACTCCTACCAATGTACTGCTACTGCCTTGTCGAGTATTTCTCTCAAAATAAATTGTGGATGATGCATTGTCCTTGTCGTATCTGTCACATTTCATCCCATAATAATTATCTCTCTCTCTCAGCGTTCGACAGAAATCGTAAAAAATTTAATGATAATGCATTGTCCTTTTCATCTCTTTCGCGTTTCAACGTGCGTAATTTGCTCGTGCATGTCCTACATGGAGTGGCTTTCAGTCATCACCTCTCTCAAGCTTCTTTTGCACCTCCTCGCCCTGAATCCGAGAGAAGAAAAGGAAGTACACTGTGAAAAAAAAACATTCCATTATAACAGAAAGGAGAAGGCAGAAAAAGAGATAGAACAAAGTACAGCCCTGCAACATGTTCAGCTATGCTAGTGTGCATGCATGCATGCTCGTGTCCTCATTCTTCATTCGTTTAAAGATTTTATTTATTTATTATAGCCTCACGCTTGTTTTTCTTAAGAATATGGTTGCATTTTTCTTTGAATTTATGGAATAAAAAACTCAGTAAAAATCACGCCTGATGGAGTGAAACACCTTTTCTTTTTTGAACAATGTGCCGTGCAAGGCAGCAGCTCTGAAATGGGAAGAGGAAAATTTCTGATTAGTGGGTAATTTCGAGATAACAGCAGGATTAAGGCATGGTAAGTGGTAACCGAGGCAGTAAAAGAAAAAAAAAACTGTGAGAGAGAAAGAAAGAACGAAAAAAAACTTGCAATTAATCCATTTGGCACTTCAACCCCTCGCTTAACCACATGGGC
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGGAGGATTTACAAGATTGCAACTCCAAAAGCCTTGTTGTTGTTCCTGGTTCTTTGGTTCTGCACCTCTTTAGGCTGTTTGGTCAGCAGGATAATTCCTGGCAGAAGTACACATTAGCTTACTTCCTTTTTGTCAGGAATGAGTACTTCCCGAGAGAGTCAAGGAAACACTCAGATGTGAATGGGCAACAAGTTCACTGCTGTTATAATTCAGAATTAGATGCGGATGTGTCATGCCCTACAGATTTGGGCAGTAAAGAATTGGAACTGAAGAAGCAGAAGCCTGTTGTTAAGACTCAATCAAGAGGTGATTCTAGTGCCAACGGATCAAATGATTGTTTCTTTCCAGGCCTTCATGATGACCTGGCTCAGGACTGCCTAGCTTGGACAAGCAGATCAGACTACCCGTCACTCTCTTGTCTGAACAAAAAGTTCAATTTGTTAATTAACAGTGGATATCTGTACAAACTGCGGATGAAATATGGCATTGTTGAACATTGGGTATATCTGGCTTGTAGCTTGATGCCCTGGGAAGCATTCGATCCTTCGCGAAAGCGATGGATGAGGCTCCCAAGAATGCCATGCGACGATTGCTTCTCCTGTGCAGACAAGGAATCTCTTGCCGTTGGGACACAACTGCTTGTCTTTGGCCGAGAATATACAGGTCTTGCTATTTGGATGTACAATTTACTGACACGTGATTGGTCCCGATGCACTCCAATGAATCTACCTCGCTGTCTATTTGCCTCGGGAAGCTACGGTGATATTGCCATTGTTGCTGGTGGGTGTGATAAGAACGGCCAGGTGCTGAAATGTGCTGAGCTGTACAATTCAGAGACTGGCCACTGGGAGACTTTACCAGACATGAACTTACCCAGGAGGCTCTCATCAGGTTTCTTCATGGATGGGAAGTTTTATGTCATTGGGGGTGTGTCAAGTCAGAGGGATTCTTTGACCTGTGGAGAGGAATACAATCTTGAAACAAGGGCATGGAGAAGAATACATGATATGTACCCTGGAGGAACCAGTGCCTCTCAGTCACCTCCTCTTGTTGCTGTTGTGAATAACCAGCTCTATGCGGCTGACCAGTTGACAAACGTGGTTAAGAAGTACGACAAAGCAAATAACACCTGGAACATAGTGAAGCCATTGCCTGTCAGAGCTGACTCTTCCAATGGCTGGGGCCTAGCTTTCAAGGCATGTGGCGATAGATTGATGGTCATTGGTGGCCATAGAGTACCCCGTGGTGAAGTAATATTGTTGCATTCTTGGTGCCCTGAAGATGGGAATGGTGCTGCTGACTGGGAGGTGCTCTCAGTGAAGGAGCGCGCTGGCGTGTTCGTTTACAACTGCGCAATAATGGGGTGCTGA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01000300G0800 gene.
TTAAATGTTTGGTAGAGAGCATAGAGCATTCAGTTCAGTTTACCTGGAACTTCTTTTTTTAAAACTCTTTTCCAAATTCGTTGTTCTTGTCTAGTATGAAATTTATGCAGTATTCTTTATTCATCATCCTTGCTGAAGAGTGTCTATCTGTTATGCCGAGTTTAGTCACATCTCGCAATTTCCTGATTCATGCCTCTGATGTGTCTGTTCAATATGTATAGAGCACTCAATTCAGTGTTCCTGGAACTTCTTTTTCAAAATTCATTTTTCTTGTCTAGTATGGAATTTATGCAGTATCCTTTATTCATCATCCTTGCTGCAAAGTCCGTATATTCATTGTGGTGAGTTCAATCACACTTCACAATTTCCTGATTCGTGTCTGCGATGTGCAATGTGTCGGTGGTACGCTGAAGGAACCTAATAATTGCGAGTCAGATGTTTCTAATAATCTACAGTCCTTGTTTCCACTTGCCCTCCTATTTTTCTTGTACCGTACTGCTATCAGAAATTTCACAGTAGGCTTAGACAGACAGGTACAGGTGGCGGCAAAAGCTGTTCGCTATATCTTACTTTCTGAAGTAATTTCTGGGAATATGTACAGTTTTCAGCTGCTTGTACTTGCAGTTAGCCAGTGGCATGACCAAGTTTGTCAGTGAATTAGTTTGACCCGGGACCTTGGCTGCTTGTGGTGAGGAGTTCCTTTCATTTCTACCTACATTTTTCTTGATTCTTCAGTTCAGTTTGTCAACTTCGTTTACTAATTACTAATGGTTTTGCCCTCCCCGAGAGCATTCTCCTGTGTGGCTGGCGACAGGGCCCACTGGCCAGCCACAAACATTGAACTGAAAACCTACAAAAACACGATTATATGAATATGATCTCTGACTTCTGCATCGGTCACTCACTTCAACGAGTTGACGAGGCAGCTATTCACAAAGCATATTTGACATGTTCACGCCGGACAATTTTTCGATACGTCATATGCGCAACGATCGTTGGCT
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01000300 Download
Protein sequence
Protein sequence
MEDLQDCNSKSLVVVPGSLVLHLFRLFGQQDNSWQKYTLAYFLFVRNEYFPRESRKHSDVNGQQVHCCYNSELDADVSCPTDLGSKELELKKQKPVVKTQSRGDSSANGSNDCFFPGLHDDLAQDCLAWTSRSDYPSLSCLNKKFNLLINSGYLYKLRMKYGIVEHWVYLACSLMPWEAFDPSRKRWMRLPRMPCDDCFSCADKESLAVGTQLLVFGREYTGLAIWMYNLLTRDWSRCTPMNLPRCLFASGSYGDIAIVAGGCDKNGQVLKCAELYNSETGHWETLPDMNLPRRLSSGFFMDGKFYVIGGVSSQRDSLTCGEEYNLETRAWRRIHDMYPGGTSASQSPPLVAVVNNQLYAADQLTNVVKKYDKANNTWNIVKPLPVRADSSNGWGLAFKACGDRLMVIGGHRVPRGEVILLHSWCPEDGNGAADWEVLSVKERAGVFVYNCAIMGC
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above