gene PH01000281G1170
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01000281:773200 - 777534(+ stand)   Name
Alternate name Locus tag PH01000281G1170
Length of gene 4335  bp Length of CDS 987  bp
Product information
Feature type
CDS
Product name
mitochondrial carrier protein
Alternate name
Molecular weight
(predicted)
35778.14152  kDa
Isoeletric point
(predicted)
9.73349380493164
Length
328  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
SNP ID Position Base in Scaffold Polymorphism
PH01SNP01880060 PH01000281:775751 T T_A
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_136369 4
Please click OG5_136369 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
Gene ID Short description Curator summary Computational description E-value
AT3G53940.1
Mitochondrial substrate carrier family protein
Mitochondrial substrate carrier family protein; FUNCTIONS IN: binding, transporter activity; INVOLVED IN: transport, mitochondrial transport, transmembrane transport; LOCATED IN: mitochondrial inner membrane, membrane; EXPRESSED IN: 8 plant structures; EX
1E-121
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os01g04990.1 mitochondrial carrier protein, putative, expressed 0
 
Function (determined by interpro in EMBL-EBI)
Protein family membership
Domains and repeats
  1. Domain
  2. Repeat
1 50 100 150 200 250 300 328
Detailed signature matches
    1. PR00926 (MITOCARRIER)
    1. SSF103506 (Mitochon...)
    1. PF00153 (Mito_carr)
    2. PS50920 (SOLCAR)
Unintegrated signatures no IPR
Unintegrated signatures
  1. PTHR24089 (FAMILY N...)
GO term prediction

Biological Process

GO:0055085 transmembrane transport

Molecular Function

None predicted.

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
specific 215754 226 321 1.22E-25 pfam00153 Mito_carr cl02813 -
superfamily 215754 226 321 1.22E-25 cl02813 Mito_carr superfamily - -
specific 215754 150 221 1.00E-18 pfam00153 Mito_carr cl02813 N
superfamily 215754 150 221 1.00E-18 cl02813 Mito_carr superfamily - N
specific 215754 41 119 8.55E-15 pfam00153 Mito_carr cl02813 -
superfamily 215754 41 119 8.55E-15 cl02813 Mito_carr superfamily - -
multi-dom 240302 41 300 1.13E-22 PTZ00169 PTZ00169 - -
multi-dom 185494 151 316 5.98E-09 PTZ00168 PTZ00168 - C
Conserved sites/feature
(0 result)
Type Brief name Coordinates Complete size Mapped size Source domain
 
DNA sequence
Upstream 1000 bp region from PH01000281G1170 gene.
AACTTTTAGTTCTATTGTTTTAGTTTTTTTTTTGTATTTGTAGGGTCCATCTAGATTTACTTTTGTCTAACTTAGTTTTTTTTTTGGTATTTGTAGGTTTCACTTATAGTTACTTTTGTCTAGTTTAGATTTTTTTTTATCTTAATACAGAAACTTGTGGTATCCATTGGATCAAAATTCTACGGCTAAGAAAAATAACTGATAGATAAAGAAATTTCAGTCATCTGAAGCACAGAGGCTCCCTTTTATGTTTTGTGAATTCACTCTACCACATCAACGATATTTTTGTATGAGCCAAAACTATTATGTCTCCTGACGAGGAGGTGTTTTGCACGGCTTAAATAGTGTTTGGTCTTAGAGTCGAGGGATGGTTTTTAGAGTTTCCAGGAGTTCAGGGCGTCAAATGTACTTTTCCTAAAATAAACGTGAGGAGGTGGAGCACGCTACGCGCTCTCCTAGGACCGAATTTTTTTTTATTAAATAATCTTTTTTTAACTTTTATTTTAAAAGTAACCTCCGGCGCATTTTATTTTTAAAAATAACCCCTTTGGTCACACCACCACTCATGACGTGACCAAACAACACTGTCACGCCAGCCCGTTTCTGGGCAAACTCTTGTCACNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCCATGAATGGTGGCGTGACAAAAAAGGTTTTTTTGCGGATTTATCCTATGGTGTGACAAGAGTTTGCCCTAACGTGACAGTGTTGTTTGATCACACCATGGATGGTAGCGTGACCAAAGGGGTTATTTTTAAAAATAAAATGCGCCGGAGGTTAATTTTAAAATANNNNNNATGGTGGCGTGACAAAAAAGGTTTTTTTGCGGACTTATCCTATGGTGTGACAAGAGTTTGCCCTAGCGTGACAGTGTTGTTTGGTCACACCATGGGTGGTGGCGTGATCAAAGGGGTTATTTTTAAAAATAAAGTGCGTCGGAGGTTAATTTTAAAACAAAAGTTAAAAAAAGATTATT
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGCAGACCGAGGCGCGTGTGGGCGTCGTCGTCGACGGCCGCGCCGCCATAGCCCGCCGCCAGGAGCAGCGCCACATCGGCACAGTCGCGCACCTCGCCGCCGGCGCATTCGCCGGCGCCGTCAGCAAGACCTGCACCGCCCCCCTCGCCCGACTTACTATCCTCTTCCAGGTGGCAGGAATGCATTCAGATGTTGCAGCTCTAAGGAAGTATAGCATATGGCATGAGGCTTCACGTATTGTTCGAGAAGAAGGGTTTGGGGGATTTTGGAAAGGAAATCTAGTGACAATTGTACATCGCTTACCTTATTCTGCCATCAGCTTCTATTCGTACGAGCGCTACAAAAAGTTTTTCCAAATGATTCCTGGCCTGGATAGAGACTCAAATTATGTTGGTGTTGCGCGTTTGCTTGGTGGTGGTTTGGCGGGAGTGACAGCTGCATCTGTAACTTACCCGTTGGATGTTGTCCGCACTCGTTTGGCAACACAGAAAACAACTAGGTATTACAAGGGCATCTTTCATGCATTGTCTACAATTTGTAGAGATGAGGGTGTCAAAGGATTGTACAAAGGCCTTGGGGCCACATTATTGGAGTTACAGGGAGTCGGGCCTAGTATAGCAATCAGCTTTTCCGTATACGAATCGCTGAGGTCTCATTGGCAAATGGAAAGGCCCAATGATTCCACCGCTGTTGTTAGCTTGTTTTCTGGGAGTCTGTCTGGTATTGCATCGTCGACAGCCACATTTCCTCTTGATCTTGTAAAGCGGCGGATGCAACTACATGGGGCAGCTGGGACAGCGTCTGTCTACAAATCAAGCATAACCGGAACCGTTCGCCAAATCTTTCAGAAAGAAGGTCTTCGTGGATTCTATAGAGGCATCGTCCCCGAGTACCTAAAGGTTGTTCCGAGTGTTGGAATTGCCTTCATGACCTATGAGACATTGAAGAGCTTGCTCTCCAGCACCGACACAGATGATGAGAACTAA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01000281G1170 gene.
ATAAAAGAAACCAGGGAATGAACTTAGAGGAGTAATGAAATTGTGAGCATTGTGAGAAGACCAGTAGAGTAATGCAGACTTTATATAGGCCGCAATACGGGAGTAGACAGATGAGTCGATGATGGCTATGAACATGACTGCACTTGAAGGAGTCCTGAGTCCCGGCCAGCTCTGCTCAGCATGCATGTGACGCTCTTTAAAACCATGCGTGTCTCAAGCGAACAGAAGTCTGTACTCCATAAGCGATATGTCCGTGTGCATTGCTGGTGCACAGGTCTGTAAAAAATTAGTGCCCGAGTCCTTTCTCTTTTGTGGCTGGTGAATGAACTGAAGACTGAAGAGGCTTTAGACAAACACATTGAGGCACTCAGCTGGAGGTTTACATTCTGAAGGTCAATGATTTTGTGTATTTTGTACTGTCAGATTCTATTTTTCGGTGGCAGCAAATGTGGCTTGGATTCTGCAAATGCAACTGCGTCTGTTTTATATTCAGATATGCAGCCATAGCAAAAATCCTCAACGGTTTACAGTCAACTTTCAGGAGAAGCGTGTCTTTGTTCAGAAATTGCATTAGCCATTCATTTGCCTTTTTATTGCTACAGGAACAGTATCACGGGGAGTGTATTGATTTCTTAAGCAAAACCCAAGCAAGATTTTCTTTTCCGGGAGTTGAAAGTCGAAACATCATACACACCACATCCATCGAATCACCTAGTCTGTGCCTCGGTTGTACCGTCTCGCGTCTCACATGCCCAATGATCTCTTTGGTATCGACGACGAGACGAGTTTCCCTGTCTCTCTCTGCCTCTTGAGACTTTCATCTCGCACGGCTCCTGCACTGCTCCTAAGTGATAAAAGAAGTGAGAAACCAAAAGCCATTCTCTGCTCCCCGCTTGAAACACAGAAATATCTCATGGAAATTTTATAGGAAAGACAAAACTAAAACCTGAACCATTTCTATAGAAAGGGAAAAAAAGTGAACCATGTGGGGCCAATTACTA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01000281 Download
Protein sequence
Protein sequence
MQTEARVGVVVDGRAAIARRQEQRHIGTVAHLAAGAFAGAVSKTCTAPLARLTILFQVAGMHSDVAALRKYSIWHEASRIVREEGFGGFWKGNLVTIVHRLPYSAISFYSYERYKKFFQMIPGLDRDSNYVGVARLLGGGLAGVTAASVTYPLDVVRTRLATQKTTRYYKGIFHALSTICRDEGVKGLYKGLGATLLELQGVGPSIAISFSVYESLRSHWQMERPNDSTAVVSLFSGSLSGIASSTATFPLDLVKRRMQLHGAAGTASVYKSSITGTVRQIFQKEGLRGFYRGIVPEYLKVVPSVGIAFMTYETLKSLLSSTDTDDEN
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above