gene PH01000242G0910
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01000242:591035 - 596982(+ stand)   Name
Alternate name Locus tag PH01000242G0910
Length of gene 5948  bp Length of CDS 1182  bp
Product information
Feature type
CDS
Product name
transcription factor
Alternate name
Molecular weight
(predicted)
41941.3965200001  kDa
Isoeletric point
(predicted)
9.37295150756836
Length
393  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
(0 result)
SNP ID Position Base in Scaffold Polymorphism
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_159727 4
Please click OG5_159727 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
(0 result)
Gene ID Short description Curator summary Computational description E-value
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os05g49420.1 transcription factor, putative, expressed 3E-180
 
Function (determined by interpro in EMBL-EBI)
Protein family membership

None predicted.

Domains and repeats
  1. Domain
1 50 100 150 200 250 300 350 393
Detailed signature matches
    1. PF07777 (MFMR)
    1. PF00170 (bZIP_1)
    2. SM00338 (BRLZ)
    3. PS00036 (BZIP_BASIC)
    4. PS50217 (BZIP)
Unintegrated signatures no IPR
Unintegrated signatures
  1. PTHR22952 (CAMP-RES...)
  2. PTHR22952:SF6 (CAMP...)
  3. SSF57959 (Leucine z...)
GO term prediction

Biological Process

GO:0006351 transcription, DNA-dependent
GO:0006355 regulation of transcription, DNA-dependent

Molecular Function

GO:0003677 DNA binding
GO:0003700 sequence-specific DNA binding transcription factor activity
GO:0043565 sequence-specific DNA binding

Cellular Component

GO:0005634 nucleus

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
specific 213400 267 310 2.31E-09 cd12193 B_zip1 cl02576 -
superfamily 243100 267 310 2.31E-09 cl02576 B_zip1 superfamily - -
specific 219569 28 115 6.33E-21 pfam07777 MFMR cl06693 C
superfamily 219569 28 115 6.33E-21 cl06693 MFMR superfamily - C
non-specific 197664 267 321 2.65E-20 smart00338 BRLZ cl02576 -
non-specific 201054 267 320 4.83E-18 pfam00170 bZIP_1 cl02576 -
non-specific 203738 269 309 8.87E-09 pfam07716 bZIP_2 cl02576 N
multi-dom 144972 271 352 0.000709411 pfam01576 Myosin_tail_1 - N
multi-dom 234501 268 347 0.00192785 TIGR04211 SH3_and_anchor - NC
Conserved sites/feature
(0 result)
Type Brief name Coordinates Complete size Mapped size Source domain
 
DNA sequence
Upstream 1000 bp region from PH01000242G0910 gene.
AGCATCTTCGCGTAGAAGTTCGTCGACGAGCTCGACATCTCCTTCCTATCAGTTCTATGAACCAAGCTTTGGCGAAGTGGTGTGTGTTGTGGTGAAGTGTTCTCCTCCAGTTTCTTCCCCCTCTTTTTATAATAGGTCATTTTGGTCTGAAAAGGTGGCGATGGAGTGTGATATTTTCGGTTTGTAAGGGTAGTGTTGTAGGGTGTTGTCATCTCGATTTGCAAAAGTAGCAGTTTATGGCGTGCCGTGGTGCGTTCTTTTTGATCTGAAAAGGAGTGTAACGGAGTGTAGCCTTTTCGGTTTGAAAAAGTAGCGTCACAATGTGTTGTCAATCCGGTCCGTAAAAGTGACACCATGTGGTATGATAGTTCATGTCACTATTTTAACTGTCGATTTGCATTCGACGACTGCCAGTAAATAGGTGTGACTTACACCTAATTTTGTAATTTTTTACGAATTTTTATATGATTATTTTTTAAATTAATATTATTTTTTTAAAAAAAATCGCTTCGAAAGCGGGGAAGCTTCGCCTTTTCGTCGGCTTAAAGTTATTTTATTTGCAGACGTGGGGCCCACGTGGGGGATGCGGCCACCACGTCACCCACATGATTGGGACGCTAAGCTGGAAATCGAGGGACGTGGGGCGGCGACGCGTAGACTGGCGAGATGGTCGACACGTGAGCGGATGGTACGCGATGGTGGGGTGACGAGGAATAAACAAATGGCCCCCACCCACTTACCGTGCCCCAGCTCACCCTCCACTTGCAGACTCGCCCATATCCCCCTCAAACACAGCCTGCACCCCAAAACTTACACGGCCATGACACTTCTTTTTCTTATTAAACGAACCATGTGTGTGCTTATATGCTTTTCCTCACTAAATTAAAATATAAGCCATATAATTTTAAAAGTAATGTGTTTAGAAAATACAAAATGCTAAAAATTTTAAGATGTTTGTATATAGAAAGTAGTATAGGATGTTTAAAAATATGAAATACCTT
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGGGCGAGACAGGCTCATCTTCGTATGCATTCGCCGCGTTCCCCGGTGAATTGGTCGTACTACGGACAAGCAGGAAAGGCATGGCACATGACGAAGCTGTGGCTACCCAGAAGACTGGGAAAACAGCCTCACCTCCTAAGGCATACTATGGCCCTGGTATCTTGCCACCAACATATTTTACCCCAGGAATAGCTCCAGGTCATGCACCTCAGCCATATATGTGGGGTCCTCAGCCTCTAATGCCACCCCCTTTCGGGACACCATATGCTGCAATGTACCCGCATGTGGGAGCTTACCCACATCCCCTTGTGCCCATGATGGCAAATCCATTGAGCATGGAGCCAGCCAAGTCTGCAAACAGTAAGGAGAAAAGTTCCAATAAGAAACTTAAGGAAATTGATGGCACTGCAGTATCCGTTGGCAGTGGTGACAGTAAAAAAACAATGTCATCCAGTGGGGATTACAGCACACAAGGCTCCAGTGATGTAAATGATCTGAAGGTGAGCAAGACTTCCAGGAAACGGAGCTTGGATGAAGGACCCGGTGCGGAAACAACCGCAGCTGCAAAGATGGAAGATGTTTTAGCTCCTAACCATGTACTGGGAGATACAGCAATTTTGCCAAATCACTGCTTTCCATCTCCAGTAATTAAGCCCAGTGCTACTAATGTTGCTAATTCAAGGGCAAGGGGCACACCAATAACTCCGATGCCTGGTGTGATGGTTTCTAGTCATACCGGAGTATCAACTGAATTATCAATCAAGGACGAGAGGGAATTAAAACGTGATAAGAGGAAGCAATCAAATAGGGAATCTGCTAGGCGGTCAAGGCTGAGAAAGCAGACTGAGACAGAGGAGCTGGCTACACAAGTAGAATCTCTTACCGCAGAGAACACATCCCTTAGATCTGAAATCAGCAGGCTAACAGAAAGCTCCAAGAAGCTCAGATCAGATAATTCCGCTCTAATGGTGAAACTGAAGGACACTGCGGCACCAAACAACGTAGAAGTGTCTCTGGAAAAAAGAGCTGCATCATCCTCTCCTCGTGTCGTGGAGAATTTCTTGTCGATGATCGACGACACAAATAAGCCGGGCATTGGCAGGCACACGGAGCACGGTGAGTCCAAGCTTCGCCAGCTCCTCGGCTCCAGTCCGGCGACTGATGCTGTAGCTGCAAGCTAA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01000242G0910 gene.
AAAAAATTCAGGACACACGAGGGTACACAAGTACAAGTATAAATGCGCGGTCTTTCCACGTATACATGCAACCGCATATACAATCTACACCGCATGCATGCGGTCTTTTTACATGTACATGTAACCGCATATACTATCTACGACATTCAAAGTACATCGAGATTTGTGCTGCACTTAGGGTGAAGAGGTGCACCGTGCGTGAATTTTTTTTATTTAATCATTTTTTTAATAATATTTTAAAATTAACCCCTCGCGAACTTTATTTCTAAATCTGACCCTTTGGGTCACACCACCTCCCGTGGCGTAACCAAATAGAACTGTCACGCCACCAGTGGCGGTGTGGCCAAAGGTGCCACGTAAGCCCTCGTCCGCGCGCCGCGCCAGCGTGGAGGGCTTGCGTGGCACCTGTCACGTCTTCTTTCTTGGCGTGACAGAGACCGATTGTCACACCTTATTTCTTGGCGTGACAGATCGCAGTTGTCACGCCATGTATCACGGCGTGACAGGGGCTATTCCAATTTGTTTGGATTCTATTTGTATAAAAAACAGTTGAAGATACGGTGGTACATAATGCCATGTACATATAACATGTCTCTATTCACAACTTGAAAATAGAGACCTCTCTACGTAAGCAAATATAACACCATCCTTTTTAGCTGAGAGTAAATAGAGTATATAGACCTGTAATCTTTTTGTACTTGGAAAACCTTAGACACTTTACAATATTTTTAGGGCGTGTCCTAGAAGTGATACATAATGCATCCTGAAAAAAAAATGAGTATACATCCTAGTGGAAAGATGCGTAGACAGTATGCTTGACAGTACCGCTGATGAAAGATGCGTAGACATCCTAGTGGAATGGTAGATGGTGTGCAGACATCCTACTGGAATCATAGGTTTGTGGTCGTAGACCAAACCGTAAACTTCTGGAACTCATTTTTGTCATGTTGTTGGATGCCTTACTACGCGAAGAATTGAAAGCGAAAAGACGACGAGATTTA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01000242 Download
Protein sequence
Protein sequence
MGETGSSSYAFAAFPGELVVLRTSRKGMAHDEAVATQKTGKTASPPKAYYGPGILPPTYFTPGIAPGHAPQPYMWGPQPLMPPPFGTPYAAMYPHVGAYPHPLVPMMANPLSMEPAKSANSKEKSSNKKLKEIDGTAVSVGSGDSKKTMSSSGDYSTQGSSDVNDLKVSKTSRKRSLDEGPGAETTAAAKMEDVLAPNHVLGDTAILPNHCFPSPVIKPSATNVANSRARGTPITPMPGVMVSSHTGVSTELSIKDERELKRDKRKQSNRESARRSRLRKQTETEELATQVESLTAENTSLRSEISRLTESSKKLRSDNSALMVKLKDTAAPNNVEVSLEKRAASSSPRVVENFLSMIDDTNKPGIGRHTEHGESKLRQLLGSSPATDAVAAS
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above