gene PH01000223G0930
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01000223:630177 - 636265(- stand)   Name
Alternate name Locus tag PH01000223G0930
Length of gene 6089  bp Length of CDS 1269  bp
Product information
Feature type
CDS
Product name
Transcription initiation factor TFIID subunit A containing protein
Alternate name
TAF12
Molecular weight
(predicted)
45342.26302  kDa
Isoeletric point
(predicted)
9.85958480834961
Length
422  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
(0 result)
SNP ID Position Base in Scaffold Polymorphism
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_186599 2
Please click OG5_186599 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
(0 result)
Gene ID Short description Curator summary Computational description E-value
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os01g62820.1 Transcription initiation factor TFIID subunit A containing protein, expressed 3E-169
 
Function (determined by interpro in EMBL-EBI)
Protein family membership

None predicted.

Domains and repeats
  1. Domain
1 50 100 150 200 250 300 350 422
Detailed signature matches
    1. SSF47113 (Histone-fold)
    1. PF03847 (TFIID_20kDa)
Unintegrated signatures no IPR
Unintegrated signatures
  1. PTHR12264 (FAMILY N...)
  2. PTHR12264:SF3 (SUBF...)
GO term prediction

Biological Process

GO:0006352 DNA-dependent transcription, initiation

Molecular Function

GO:0046982 protein heterodimerization activity

Cellular Component

GO:0005669 transcription factor TFIID complex

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
KEGG orthology Functional Subsystem Pathway
Genetic Information Processing Transcription Basal transcription factors  
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
ID for KEGG orthology Reaction description EC number
K03126 transcription initiation factor TFIID subunit 12
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
specific 173964 280 351 3.15E-35 cd07981 TAF12 cl17384 -
superfamily 247938 280 351 3.15E-35 cl17384 TAF12 superfamily - -
non-specific 112650 282 348 1.24E-35 pfam03847 TFIID_20kDa cl17384 -
non-specific 227911 260 358 4.77E-19 COG5624 TAF61 cl17384 N
Conserved sites/feature
Type Brief name Coordinates Complete size Mapped size Source domain
specific heterodimer interface L280,L281,K285,L289,Q292,V293,L307,I310,A311,D312,F314,I315,D316,T319,A320,C323,A326,S332,L334,E335,A336,V339,L340,L343,W347,L349,V351 27 27 173964
specific Heterotetramer interface D300,E302,V303,L306,E309,I310,D313 7 7 173964
 
DNA sequence
Upstream 1000 bp region from PH01000223G0930 gene.
GACCATAAAAAGCAGAATTTGTGTTTGTGGAAACTCTCAGGCTGAAAACGAAGACGAAGATTTTGCCAAAAATACGGAGTAAAATATGTTGATTCTCAGATACCAAAAAAAGTGAGATACATCAAACTCGTATGTCCCACAACTCATGTATGGTATCTGAAAGGTCTTCCTAATTATATCGCGAACCTTTTAAGATAAACCTCTCAAGAAATTGGAGGGTTAGTACACGGTGATTTCTCTTTTGACATGATGCATGGGTTGCATCAATTTTTGTTCTCGGTTTGTTTTGTTGATTCGTCTAGAGTCACCCAGCGAAAACATTACCGGTAAAAAATTTTTATCGGAGGGTTGCGATAATACCGGTTTTCGCCGGTTATCGAAAGTTTTGAATTGGAATTTGGAAATTGAATTTTTCAGATGTAAAGATGAAATTTAGCAAAATTTTGAATTTGAATTTAGATGAAAATTAAATAAATCCGAAATTTTTTTGCCCAGTATAAAAATTTGACCACACTGATAACACCAGCAAAATTTCGGCAATAGAATTTTCACGGGAGTCACCTCGTGTTGGTGACATACTGGTTATGATATGGGTGTTTCTGTTCTCTTCCTGGCGATGCGAAGCATCAGTTTAAAAGATGAAACGGCGTGACCACCGCCAAGATCGCTGAATTGTTGTTAACACGTAGGCACAACCGCACAACGCCCAGTAACAAGATATGATGACACCTTATAAATCATTAACTTATGAGTTGGTGTAGCAACAACACGATACCAGAATATAAGCTCCCCATCTACATAGAAGCATCAAAATCGAAAAGGGCCGCCCCATTTGCCAAAAAAAACTTTATGTACAACGAACGGGGGAAGCTACAGAGATTCGAGGATGATAAGGTTACAGATAACTCCTGCAGCAGCCTGTCTGTCGCGAATAATCTGTCAGTAAGTGTTTTCCTTTTGAGTACTCAAGCATCCGCCGTTTGCCCATAGATGCTCATAGA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGAGCTTCTCGGGCGGCGGAGGGCAGTTGGGGCAGCAGCAGCAGCTGGCAGCGCGCGCGGCCATGCTTGGGCAGGGGCAGCTGGGGATGCTGCAAGGGCAGGGCAACGCGGCCGCGGCGCACTACGGGCTCCAGTCACAGATGATGGCGCAGCCAAGGCAAAAGGGCATATTACAAGGTGCACAATTTAATACTGCCAACGCAGCTCAAGCGTTGCAAGGGATGCAGTCCATGGGAGTTATGGGTACTTTTGGGATGAACCAGATGAGACCAAATGGAACTATTCCATATGGTGCTCAACAACGTTTTGCCCATGCACAGATGAGGCCACAGCAAGGGTCGCAGCAAGCCGCACTATCTCCACAGAAGGTAGCTGGTCAAGGCTTGTCGAGACCATCATCAATTGCAGCATTAAATTCACAACTACCTGGATCATCGCAAAATGGACTGATGGTGCAAATGTCTCTGCCTCAGCAGCAGCAGCAGCAGCAATGGTTGAAGCAAATACAGTCATCGATGGCCTCACCTGTTTCTTCACATCAATTTCAGCAGCAACAAAGGATGATGTTGATGCAACAATTTCAGCAGAAGTCAGGATTGAGTCAACACCAAATTGCACAAGCCCAACAGCAGCATCCACATCTCAATGCCCTGCAGCAGCAACACTTTCTGCAGCAACTTCAACAGCAGCAACAGCAACAGCAACAATCTCCAAGGATATCAGCATCTGGTTCTCAGAAGTCCGTGAACTTGACAGGATCACAACCGGGCACACCTTTGTCAGGTGGAACTATGGCGGGTGGAAGTGCGAGTCAAGGACCAGACGGAACTAACCAACTTCTCGGGAAGAGAAAAATACAAGATTTGGTTGCACAGGTAGATCCCCTTGGCAAGGTTGATCCAGAAGTGGAAGATTTGCTTTTAGAGATCGCTGATGATTTCATTGACTCGGTAACTGCATTCGCATGCAGCCTGGCAAAGCACAGGAAATCATCAGTTCTGGAAGCCAAGGATGTGTTGCTGCACCTAGAGAGAAATTGGCATTTATCTGTTCCTGGTTTCTCAAGGGAGGATAAGAACCCACAAAGAAATCCTGTAAAAGCATCGGTGGACCCCCAACAACTGGAATGTGAAGCTGCTGGTGTTAGCAGCACGATCAATAAACTGGTTGCTAATAATTCAGTTGGCAACCATCAAATAAGAGCGCCAGTTGCAGAGCCTTCACCAATGCCCACAGTGGGCCCTCTGTCAAAAGTGCCCCGTTTCTGA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01000223G0930 gene.
GATGGCTTCCTTTTGCGCTTCCCCATATAGATAGCTCCGAATTTGTATTTTATTTTGCTTCAAAGTTATAACCACGTTAAACTACCTATCCCAGTGGTGTTTGGCATATTAAACCACTTACCCATCTATTAACCACGAAGCCAACATAGCCTTAGGTTGATTTTTTAAAAAAAATAATATATTTTTAAAACAAAATTACAAAAATATATAATCGCCCCAAAAAATTACAGAAATGAGTTCCTGTCGCCAGTTGAAATGGCGACAAGAACCTATCGCTATTTCAACTGGCGATAGGGACCCTGATCGCTCCTGTCGCCGGCCCAACTACTTATCGCCATTTGAAATGGCGATAGGAATGTGAACAGTGTTCCTGTCGCCATTTCAAATGGCGACAGTATGCCACGTATAAAATGTCGTAAAAATCCTTCCAAACCTCATTTTAATTCCAAAAAAAACAGAATCGAGAAGGAGAGGAAGAGAAAGAAAGGTAGTGAAGCGCTGCTCGTTCGTCGCGGAGGAGATAGATTCAGAGAGCAGTGGATCTAGTAGACCGGTCATCTTGCAGGTACATTTTTCGATTAGAATTAAGTAGATTAGCGAGTAGAATGAAGTAGATTAGCGAGTAGAACGAAGTAGAATATGGACATAGAATCAAGTAGAATAGCGACATAGAATTAAGTAGAATAGATAATTGTAGCGAAATTATGTATAGAATTGTAGTGAAAGAGCGACTAGAATCAAGTAGAATAGGGACTAGAATGAAGTGAAATATCGACATAGAATCAAGTAGAATAGCGACTAGAATGAAGTAGAATTGCGACATAGAATCAAGTAGAATAGAAATTATGTATTACATTATATTTTTTGAAATTTGTACATGATGTCAAATTATGTAGAATAGCAACATAGAATTAAGTATAATATCCAGTAGAATTAAGTACAATAACGAATAGAATCAAGTAGAATAGGGACTAGAATGAAGTAGAATATCAACATAGAAT
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01000223 Download
Protein sequence
Protein sequence
MSFSGGGGQLGQQQQLAARAAMLGQGQLGMLQGQGNAAAAHYGLQSQMMAQPRQKGILQGAQFNTANAAQALQGMQSMGVMGTFGMNQMRPNGTIPYGAQQRFAHAQMRPQQGSQQAALSPQKVAGQGLSRPSSIAALNSQLPGSSQNGLMVQMSLPQQQQQQQWLKQIQSSMASPVSSHQFQQQQRMMLMQQFQQKSGLSQHQIAQAQQQHPHLNALQQQHFLQQLQQQQQQQQQSPRISASGSQKSVNLTGSQPGTPLSGGTMAGGSASQGPDGTNQLLGKRKIQDLVAQVDPLGKVDPEVEDLLLEIADDFIDSVTAFACSLAKHRKSSVLEAKDVLLHLERNWHLSVPGFSREDKNPQRNPVKASVDPQQLECEAAGVSSTINKLVANNSVGNHQIRAPVAEPSPMPTVGPLSKVPRF
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above