gene PH01000222G1190
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01000222:783760 - 791181(+ stand)   Name
Alternate name Locus tag PH01000222G1190
Length of gene 7422  bp Length of CDS 1077  bp
Product information
Feature type
CDS
Product name
OsMADS14 - MADS-box family gene with MIKCc type-box
Alternate name
Molecular weight
(predicted)
38062.15372  kDa
Isoeletric point
(predicted)
8.15690231323242
Length
358  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
SNP ID Position Base in Scaffold Polymorphism
PH01SNP01550930 PH01000222:784201 C C_G
PH01SNP01550940 PH01000222:785211 A A_T
PH01SNP01550950 PH01000222:789781 A A_G
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_170388 3
Please click OG5_170388 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
(0 result)
Gene ID Short description Curator summary Computational description E-value
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os03g54160.2 OsMADS14 - MADS-box family gene with MIKCc type-box, expressed 4E-60
 
Function (determined by interpro in EMBL-EBI)
Protein family membership

None predicted.

Domains and repeats
  1. Domain
1 50 100 150 200 250 300 358
Detailed signature matches
    1. PF01486 (K-box)
    2. PS51297 (K_BOX)
Unintegrated signatures no IPR
Unintegrated signatures
  1. PTHR11945 (MADS BOX...)
GO term prediction

Biological Process

GO:0006355 regulation of transcription, DNA-dependent

Molecular Function

GO:0003700 sequence-specific DNA binding transcription factor activity

Cellular Component

GO:0005634 nucleus

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
non-specific 216525 201 287 5.98E-12 pfam01486 K-box cl03234 -
superfamily 216525 201 287 5.98E-12 cl03234 K-box superfamily - -
Conserved sites/feature
(0 result)
Type Brief name Coordinates Complete size Mapped size Source domain
 
DNA sequence
Upstream 1000 bp region from PH01000222G1190 gene.
TGCTGAGGGTAGATCGTTCTTGTATCACTTAGCATATGAACGTCCATAGAGGCAACTTGTAATGGAGAGACATATATAATTATATAGCCTTAACAAGTCTTCAGGTAATCAAACGTACAAAACTGCTGTACGATGTCATACAATTGCTTCTCTCTATATATAATGGCAATTAACCTTTTGCATGTTATCTAATTCAAAGATAGGTGCTACCCTTCTTAATGCAATGAGCGCAAATCTTTTGCGTTTTCTCGGAATAAAAGGTGTTACCGTCCAGTTACTTAGCTCTTTTTTATATATTGACCTTATATATTTTCCGTTGTCCTAGCAATTTACCTTATGTATGTTATTTTTTCCAAAACGTTACTAGTATTGAGTATCCATTTTGAAGAGCTTGTATCTGATACAAATTACCTTTTCATGTAAATTTGTGCAAAGTAACTAGCATAAAAAATGTTAGAACAATTTGAGGAAAAAGTGAAGCTAGGGCTTGATATGCTCTTAACAACTGAAAATAACAATTAAATAGTAATTCTGTTGTTCATATCCCTCTTATATATTTTCACTGTAATATTATGTTTTAGAATATCTAACATGGCATTCAAAAAATCACTAACACCCTTCAGTTTAAGACTTCACCGTGTGACTGCGCCACACCCTTCAGTTGTATTGATAATACTCCGTTAGTACAGAATCTACAGGCTAGCATGAGTTCTTAAACAGCTAGCTAAGAAATTCTTGAAACAGGTTCATGTTGAAACTGAAGGGGCTAAACCACAGTTAACAAGAGGTCAGAGCCATAACACGTGTGTGTTTATATAGAATGCAAGCTTTCTTGGTTCTTGGGTTTGGTTTTTTACTTTTTCTATTGCTATTTTTCTATCACTGTTGTTATATATGGAGATATCTTTTGGGTAAATAAATGTTGGAGAAATTAGTGTTAGGGTTTAATAAGAGTCCAGCCGTGTGTGAGTTGTGCTAGAGCCGGACTATAATATTTGACA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGTGCGGGTGCGGTAGTGGAGTCGATGCTACGACGCAGTTGGTGGCGCAGAGCCGTCGCGTGAGGGCGACGGCGGATCGGCTGGATCCAGCTGGAGGTGGTGGGATCCAGCGGCCCATGGCCGGCCAACACGTTGAGATGAGCCTTGAGCCGCCTCCTGGTGGAGGTTGTGGTCTCGGAGTCGGGGAAGAGGTCGTGGCTGCAGCTCCTAGAGGCGGTGGTGCGGTTGCTCCTAGAGGGGGTGGTCTCGGAGTCGGGGAACATGTCACGGCTGCGGCTTCTCTTGGAGGGGGTGGTCTCAGAGGAGCTCATCGAGGAGGTGAAGCCTGTGGAGGATCCGCCACGGGGGAGGGGGGAGGCTCAGGCTTGGTCGAAGAGGTGCGGGATAGAAAGAAAAAGATCAGTGGAGGATCTGGTGTGATTGGTGGAGGATCTGGTGTGGATCCAGATCGTATGGACAAAATTCTTGAACGGTATGAGCGCTACTCCTACGCAGAAAAGGTTCTTATTTCAGCCGAATCTGAAACTCAGGTAAAGTTTGTAAGTGGGCAGCATGACATTGTCCTCACCTCTGCCGCTATCGCCTCGATTCTTCGCTTTCATGGCAACTGGTGTCACGAATATAGGAAACTGAAGGCGAAGGTTGAGACGATACAGAAATGTCAAAAACACCTCATGGGAGAGGATCTTGAATCTTTGAATCTCAAGGAGCTTCAGCAGCTAGAGCAGCAACTGGAAAATTCACTGAAACATATCAGATCCCGAAAGAGCCAACTTATGCTCGAGTCCATTTCCGAGCTTCAAAAGAAGGAGAAGTCACTGCAGGAGGAGAATAAGGTTCTGCAGAAGGAACTCGTGGAGAAGCAGAAGGTGATCCGTAAACAGCAAGTGCAATGGGACCAGACTCATCCTCAAACTAGTTCCTCTTCCTCGTCCTTCATGATGAGGGAAGCTCTCCCAACAGCGAATATCAGTAATTACCCTGCGGCAGCCGGCGAGAGGGCAGAGGACGCAGCAGTGCAGCCCCAGGTTCGCATGGGGCTGCCACCATGGATGGTGAGCCACATTAACGGATGA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01000222G1190 gene.
ATAAATAAATAAATATGAGCATTGTGCGTAGTGATTGATGTAAGATAAATAAACTCACTTTGATGTCTTTGTTACCTTCCCATATTGGCTGAAATGGTCGGCCCCAAAAGGCAGAGCTGGGAGCATGCTCAGATAAAGAGGTATCGCTATGGTTTAAACATCAAAAGGTAATACAATCGATTTGTACTAATAATAATATTACTCGTATGGAATACTCCAATGTCTCCCACGCACCAAGTTTTATTAAATGCAGATGTATGGAATTGCAGACAAACAGATTGAACCACCAGCGGTCTTTCCGAAGGAAAAAAAACATAGTATTCTGTCAGTTAAATTATGAAAGATCATCTGTATAGAATGCCATCTCTCCTATACAAACATTTTCCCCATCATAAACAAAGAAAAGCATGTGAGCTAACAAGAACCCCTACCACTAAAAAAATTTAAGGATAATGAATGCTCAGCACTAGTTCTAAGGATGGCACTGTTTGATGTTCAACATCGAATAACTTTAGAACAGTTGAACTTGAGCCTGCTGATGAGATTTCAGCCTACGAAAAAGATAATCCAACTACAACTGGTAACAAAAAGAAAATGATTGGGGATGGTTTAACTGATCTGGGATATGCTATTAAAAAACACGAAGCAGCTTCTCTTTCAGGCGTGAAATAAACTTGAATGTCTCCTCTGCCTTGGCCTGTTGATAAATATCACTTCTTGATACTCTGTCCGGATGGAATTTCAGAAGAGCTTGTTTATAGGCAGCTTTAACCTGAAAAGTAAGTATCATCCCAAAATGACTATCAGAGAGGGAGGAAGAGAGATCAATCATTTCTTATTTATATATATGGTCATCACAGAGAAAAATATATTTGTCAGTGTTTACATAAAAAAATTGTATAGATTTGGGTCAGAGCATTTTTTATGAAATCCGATGTAACAACCCAGATTTTGCCCTTTTCATAAATTTATTTCAAATTAATTAATTCAAATTGTTAGCC
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01000222 Download
Protein sequence
Protein sequence
MCGCGSGVDATTQLVAQSRRVRATADRLDPAGGGGIQRPMAGQHVEMSLEPPPGGGCGLGVGEEVVAAAPRGGGAVAPRGGGLGVGEHVTAAASLGGGGLRGAHRGGEACGGSATGEGGGSGLVEEVRDRKKKISGGSGVIGGGSGVDPDRMDKILERYERYSYAEKVLISAESETQVKFVSGQHDIVLTSAAIASILRFHGNWCHEYRKLKAKVETIQKCQKHLMGEDLESLNLKELQQLEQQLENSLKHIRSRKSQLMLESISELQKKEKSLQEENKVLQKELVEKQKVIRKQQVQWDQTHPQTSSSSSSFMMREALPTANISNYPAAAGERAEDAAVQPQVRMGLPPWMVSHING
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above