gene PH01000190G1320
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01000190:840056 - 844904(- stand)   Name
Alternate name Locus tag PH01000190G1320
Length of gene 4849  bp Length of CDS 1425  bp
Product information
Feature type
CDS
Product name
eukaryotic translation initiation factor 3 subunit E-interacting protein
Alternate name
Molecular weight
(predicted)
55435.8028200001  kDa
Isoeletric point
(predicted)
6.38559341430664
Length
474  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
SNP ID Position Base in Scaffold Polymorphism
PH01SNP01347420 PH01000190:843938 C C_A
PH01SNP01347430 PH01000190:843962 A A_G
PH01SNP01347440 PH01000190:844384 C C_T
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_128650 3
Please click OG5_128650 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
Gene ID Short description Curator summary Computational description E-value
AT5G25757.1
RNA polymerase I-associated factor PAF67
RNA polymerase I-associated factor PAF67; CONTAINS InterPro DOMAIN/s: RNA polymerase I-associated factor PAF67 (InterPro:IPR019382); BEST Arabidopsis thaliana protein match is: RNA polymerase I-associated factor PAF67 (TAIR:AT5G25754.1); Has 30201 Blast h
0
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os01g12870.1 eukaryotic translation initiation factor 3 subunit E-interacting protein, putative, expressed 0
 
Function (determined by interpro in EMBL-EBI)
Protein family membership
Domains and repeats
None predicted.
Detailed signature matches
    1. MF_03011 (eIF3l)
    2. PF10255 (Paf67)
    3. PTHR13242:SF0 (SUBF...)
Unintegrated signatures no IPR
Unintegrated signatures
  1. PTHR13242 (EUKARYOT...)
GO term prediction

Biological Process

None predicted.

Molecular Function

GO:0003743 translation initiation factor activity

Cellular Component

GO:0005737 cytoplasm
GO:0005852 eukaryotic translation initiation factor 3 complex

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
multi-dom 220655 1 376 0 pfam10255 Paf67 - -
Conserved sites/feature
(0 result)
Type Brief name Coordinates Complete size Mapped size Source domain
 
DNA sequence
Upstream 1000 bp region from PH01000190G1320 gene.
CATACTTGCACGTGATGTGTTAAATGTTCATGTCTCAACGGTTTTCTCCGAGTCTGCTTTCAGTCTTTCTGAAAGAATATTGGTGGAGCGAAGAACAAGTCTCACAAGTAAGATGGTGGAGATACTTCTAACTGTGAAGGAATGGGAACAAGCTGATTCACGAACACAACACTTTGTGGAAAATCCACAGTTGTCAAAGGTGTTCAAAAATCTATACTTAGACAATGACACGTTAAACAAGGATGTATGTAGAGCTATTGGCTGTACTCTTTTTCCTTTGCCAAGGTTTTCTCATTTTTGAGTTTTTACTTAGTGAAAGTTGTAACGAGGCAGTCAGTTGAACATTAATAAAGCTCTTTATTGCATTTTCAATATGATTGTCTTTTTTTTATTATTTTCATACCTATTTCCGAATTCTACACATTTTTCTGTTTTTTTTTTTCGATTTTTTCAGGTCTAACCGGCTAAATAGGTCGGCCTTAGCCCGCTGGGCCAAGCGGGCTTGTACCAGCACGGCACGAACAACCGATGGGCCGTGCCTAGGCCGCCTCCCTAGCACGTGGCCAGCACGGCACAGCCTATGTAATAGCCGGGCCAGGATGGATCGTGCCTAGATGGGTCGGGCCAGCTCGTGCCCGTGCCCGTGCCATGCCAGGCCGTCCATTTGGCCAGCTCTAGGCGAGATACGGAGAGAGCGATGCTTGTACGAGAGAGAGGGGGGGAGAGATTAATGGGTGCAGGTTTTTTTTTTTAGCGGTGGGTTCCACCGGAAAGAAGAGGATGCGCTAAACACTGAAGTAAAAAAATAGTTCTAGCACCTTTATAACATGATGGTGAGATCACGAATTTGGCACCGCCTACATTACATAGCCTTACAATCAAGTTCAAATGCAGGGAATTAAAAAAAAAAAGAGAGAGTTCGGACGCAAGGCAACAATAGGCACTTAACGCCAGAAACCTAGACCTCGCATACGACAGGATCTGCACCGCACGTAAAATCT
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGCAGCTACCCAACCAGTGGCTCTGGGACATGATCGATGAGTTCGTTTACCAGTTCCAGAGCTTCTGCCAGTACCGCGCCAAGCTCAAGAACAAGACCGAAGACGAGCTCCAGCAACTCAAGCAGTTCGACAAGGCGTGGAATGTGTATGGGGTCCTCAATTACCTGCAAGCGCTGGTGGAGAAGTCCATGATCGCACAGATCCTGGAGAGGGAGAAGGAGGGGCTGGAGCAGTTTACTGCCACAGACGGGTACGACTACGAGGGTGGCAGCAATGTGCTCAAGGTGCTGGGTTACTACAGCATGATTGGGCTGCTCAGGATACACTGCCTCCTCGGGGATTACCACACTGGCCTTAAGTGCTTGGCGCCAATCGACCTGAACCAGCAGGGGGTCTACACCATTGTGATTGGGAGTCACATCTCCACGATCTATCACTATGGGTTTGCAAACCTTATGATGCGCAGGTATGTTGATGCCATACGTGAATTCAACAAAATTCTGCTATATGTTCTGAAGTATAAGCAGTACCATCAGAAATCCCCTCAGTATGACCAGATACTGAAGAAAAATGAGCAGATGTATGCACTGTTGGCAATTTGCCTCTCTTTGTGCCCGCAGAACAAACTCGTAGATGAAAATGTTAGCACCCAGCTGAAAGAAAAGTACAATGACAAAATGACAAAGATGCAGAGGTTTGATGATGAAGCGTATGCTGCTTATGATGAACTATTTTCGTACGCCTGCCCCAAGTTCATTACTCCAGCACCTCCAGTTCTGGATCAGCCGCTTACAAATTATAACCAGGACGCCTATCGTCTTCAATTGAAGCTGTTCCTTTACGAAGTGAAACAACAACAGTTGCTTTCTGGAGTTCGAAGTTATCTAAAATTATATTCAACAATAACCACTGCCAAACTTGCCCAATATATGGAAGTGGATGAGGCAACACTTAGGTCAATCCTGATGACATACAAGCACAAAATGCATGCAGTTGACAGTAATGGAAAGATTGTATCCAGCACAGACTTCGATTTTTACATTAATGAGGATATTATTCATGTTGTGGAGTCCAAGGCGACCAAATGCCATGGTGATTACTTTTTGAAACAGATTTTGAAGTTTGAGGAAATGATTGGGCGAGCTAGGGGCAGTGACTGCAGAATAGAGGAACGACACCAGCGGTGGACTTCGGCGGTCCTCCGGCTTGGATGGCGGGAGCATGAGAACCACGAGGATGTGGGCAAGCTGCCATTGGTGACAAGCGAGGAGATGACAACGATGCAGAGGAGGGTGAGCGCAGAGTCGTCGATGAAGGCGAGGGGGACGCCGGAGGCGGAGCTGGAGAGGGAGACAATGGCATGGATGGAGGGGAGGCATGGAGAGTTGGCCGAGAAGGAGGTGGCGGCCTTGAAGGTGAGGTAG
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01000190G1320 gene.
GAGAGCGTTTAGCTAGTTTTAGAGTGGGGTTTTGTGGTTGGGTTTCTGCGGGCCTCGCAGATGTGGGGAAGGGCGGGATCACGAGCGACGCGGCCGTGTGGGCCTTGGGATTTCGCGGGATTTTAGCCCGTTTCTTGCCTTTCGGCCGGCTCGTCTGGTGCCGTTTGGCCCAACACGTCTCGTGCCGTTGTGGTAGTCCCTCCTCGCCGGACGCTGCGTGAATGTTTTTAAAAATTAATATTAATTTAAAATATAATTACAAAAATAAATAGCTATTCTAAAAAATTACAAAAATTGCTCACTTTCACCAGTTCAACTGGCGACAGGAACCCTCTGTCGCCGGTCTAGCTTCATATCGCTAGTTCAACTGGCGACAGAGAGCTGAAACCCTATAAAAACTCCTTCAAACCCTAAAATTCGGCATATGACTTATCTTTATTCAGAAAAAAAGAGAATGGGGGAAGAGAGAGGAGTACAGGGGTGGAGAGAAGCTAGCGAAGCGCTGTCCGTCCGGTTGCCCACATGTCGAGTAATTTTTTTAACCGAATGAATTGCATAGTTTTAGATGTACGATTACGTAGTGCAATATGTTTTACATAATACTTTTCGGTGGATAGTCTAGTTTTATATATGTGGTTAATCGTGAAAATGTTCTTTATAGTGTAGTACGTCAGATATGTCTGACGTCACCAATTTCAAATTTTACTACGATCAGGAGACTATTATGGAGGGTCCCGAGAGGATTGATTTGCGTTATTTCCAATCGGCGACCGTGTTCCTACCAAGACCAGAGCAGCGTACATGGGGTGTTGTGATACGGTGATTGTTCCACATATTCCAAGTGGGTCGTGATGTGTACGATCTGAGTTTGAGTTGTCTTGCCCCCAGAGCAACACAGCCCACATATTCAGAGTTAGTGCAGCTGAAGGGAACAAATTCATGGTAGTCGTATGTACGCATGATGAGGGATGGATGGTGGAATTTGGTCCTTCTAGCTCAGG
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01000190 Download
Protein sequence
Protein sequence
MQLPNQWLWDMIDEFVYQFQSFCQYRAKLKNKTEDELQQLKQFDKAWNVYGVLNYLQALVEKSMIAQILEREKEGLEQFTATDGYDYEGGSNVLKVLGYYSMIGLLRIHCLLGDYHTGLKCLAPIDLNQQGVYTIVIGSHISTIYHYGFANLMMRRYVDAIREFNKILLYVLKYKQYHQKSPQYDQILKKNEQMYALLAICLSLCPQNKLVDENVSTQLKEKYNDKMTKMQRFDDEAYAAYDELFSYACPKFITPAPPVLDQPLTNYNQDAYRLQLKLFLYEVKQQQLLSGVRSYLKLYSTITTAKLAQYMEVDEATLRSILMTYKHKMHAVDSNGKIVSSTDFDFYINEDIIHVVESKATKCHGDYFLKQILKFEEMIGRARGSDCRIEERHQRWTSAVLRLGWREHENHEDVGKLPLVTSEEMTTMQRRVSAESSMKARGTPEAELERETMAWMEGRHGELAEKEVAALKVR
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above