gene PH01000188G0820
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01000188:576996 - 582200(+ stand)   Name
Alternate name Locus tag PH01000188G0820
Length of gene 5205  bp Length of CDS 3048  bp
Product information
Feature type
CDS
Product name
OsNucAP1 - Putative Nucleoporin Autopeptidase homologue
Alternate name
NUP98, ADAR2
Molecular weight
(predicted)
115050.14902  kDa
Isoeletric point
(predicted)
5.01728439331054
Length
1015  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
(0 result)
SNP ID Position Base in Scaffold Polymorphism
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_127364 3
Please click OG5_127364 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
Gene ID Short description Curator summary Computational description E-value
AT1G80680.1
SUPPRESSOR OF AUXIN RESISTANCE 3
Mutant has early-flowering phenotype, encodes a putative nucleoporin. Required for the activation of downstream defense pathways by the snc1 mutation. Involved in basal resistance against bacterial pathogens.
SUPPRESSOR OF AUXIN RESISTANCE 3 (SAR3); FUNCTIONS IN: porin activity; INVOLVED IN: mRNA export from nucleus, defense response signaling pathway, resistance gene-dependent, response to auxin stimulus, negative regulation of flower development, development
0
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os03g07580.1 OsNucAP1 - Putative Nucleoporin Autopeptidase homologue, expressed 0
 
Function (determined by interpro in EMBL-EBI)
Protein family membership

None predicted.

Domains and repeats
  1. Domain
1 100 200 300 400 500 600 700 800 900 1015
Detailed signature matches
    1. PS51434 (NUP_C)
    2. SSF82215 (C-termina...)
    3. PF04096 (Nucleoporin2)
    1. PF12110 (Nup96)
Unintegrated signatures no IPR
Unintegrated signatures
  1. PTHR23198 (NUCLEOPORIN)
GO term prediction

Biological Process

GO:0006810 transport

Molecular Function

None predicted.

Cellular Component

GO:0005643 nuclear pore

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
KEGG orthology Functional Subsystem Pathway
Genetic Information Processing Translation RNA transport  
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
ID for KEGG orthology Reaction description EC number
K14297 nuclear pore complex protein Nup98-Nup96
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
specific 221425 538 827 1.97E-83 pfam12110 Nup96 cl13536 -
superfamily 221425 538 827 1.97E-83 cl13536 Nup96 superfamily - -
specific 202886 14 144 2.94E-41 pfam04096 Nucleoporin2 cl04399 -
superfamily 202886 14 144 2.94E-41 cl04399 Nucleoporin2 superfamily - -
Conserved sites/feature
(0 result)
Type Brief name Coordinates Complete size Mapped size Source domain
 
DNA sequence
Upstream 1000 bp region from PH01000188G0820 gene.
CACCTTGTTCGTCTTCATTGTCTCCCTGAATTGGCTATCCTCCTCCACCCTCTTCCTCTTCTCCAGCTTCTTTCTCTTCTGCTCTTTTCTAGATCTGCAGCGAGTAAGCACATGGCAACAACAAATCGGAAAAGGGGAGGTCGAATCAAGAACTGCAAGAGGGAAGGGGAGGATACAAACCTCTTGGATAGTGGGCCAGTGGCGGCTCCTCGCCGTCGCGGACCTCATCGTCGCACGGATGACGTTGCTCATCGCCGCCTGCACCAGACGTTGAGCGTTCGCCGTCCGCCATACCATCGGCACCAGCAACCCCGCCGGATCCGTCTCCCTGTGCACCCTGCCGCGGCACCCCTCCGGATCTGCCGCCCCGTGCGCCCTCTCTGCCACGCCCCGTTGGATCCGCCGCCCCGTACGCCCTCGCTGCGGCAGATCTGACGCGAGGCCGCGGGGGCACCACCGCGACCGCAAGCCGTGCTGCGCCGCGGACCAGCAGTGGTGTCCGCAAAATGACCGCTGAAGCGTTCGCAAGACGCCGTGGGTGTTCGCTAAACAGATTTTGCGAGATGGGCCAAGTGGGCTAAGTGGGCTTCCGTGCCCACTTGCATCCCTAGTTCCATCGATTTTTTTTAAATAATCTATTTTTTTATTCAGAATTACAGAAATAATACCACCTTTTTTTATTTTACAAGAATAATCATATGTCGCTCACCCGTTGGGCGACTAGCATAAGTCACTCAACCGTTGAGCGACTTGGGCCTAGTCGCTCAACGGGGAGCAACTTAGATGCTCAGCGGTTACAGCTCACCTAGCTAGTAAGGCATGAATTCTGCCCGATGAACGACAAGTGTCCAAGTCGCTCAACCGTTGAGCGACTTGGTTTGATGTCGCTCACCAGTAGGGCGACTAGACCAAGTCGTCCAACCGTACGGCGACACGGGATTATTTCTGTAAAAAAAAATTAAGCGGTATTATTTCTGTATTTCCTAATAAAAAATAGATTA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGGCTGGCGATGCCATGTTCCCCGTGCTGCATTCCTCCGATTATTTCACGAGGCCGTTGATCGATGAGCTGGTTGAGAGGGAGGCGGCTGACCCAGGCTACTGCAGTAGGGTTCCAAACTTTGTCGTCGGGAGGGTGAGGTATGGGCAGGTTATGTTCCCTGGAAACACCGATGTGAGGGGGATGGACCTTAATGAAATTGTCAGGTTTGACCGCCATTATGTGGTGGTTTATGAGGATGAGGCCGGTAAGCCCCCAGTAGGGCATGGTCTTAATAAAGCAGCAGAAGTGACGTTGAAGCTGGATTTGAGGAAACTTCCAGAGCCCAGCATCCTTGTTGAGCTCCTAAGGTGTCGCTCGAAAAAGCAAGGTGCTAGGTTTCTTTCATTCAATCCAGTGAATGGCAGATGGAAGTTTGAGGTTGATCATTTTAGTAGATTTGGTCTTGTGGACGAGGAGGAAGAGGATGTTGTTATGGATGAGTCAGTTGTTCGGCAGCCGATTGCTGAAGTAAGAGACCCACCTGCAAATGGTTTAGAACTGGAGCTTTCGCATTCATTGCCTGCTCATCTTGGGCTTGACCCTGCGAAGATGCAAGAAATGCGGATGGCGATGTTTTCCAACGAGGAAGATGATGAATATATGGAGGATGGCTTCCCATCTGATCAGAGATACCTTAGCAGAGAAAGGATGAATGTGGATTCACCCAACTCAAGTGCTAACGGTCCGAGGCTGAGGTCTCTCTCTCCTTTGCACGGTTCTTCTCAGAAGATCGGAAGGAGACCTGGTATTCTTGCAAGGAAAGAACCACAGGCACTGTTGGAATATAGTGTAAATTCTTCAGAGCTTGGTCCGTCTTCTCAGGGTATTCTTATGTCTGGGCAAAACAAGGGCTTTCCAGTGAGAATGACCAAGGTGGAAGGCTTTAAGCTGCCGGCTGAGCAAGCAACTCCTGTTGCTGGAAAAATATATACTAATTGCGTTGCGGATGCTGCTTTATTTATGGGTAGATCATTTCGAGTTGGTTGGGGACCAAATGGCATCCTTGTTCATTCTGGTAGTCTGGTCAATAGTCCTGGAAACAGCCTATCTTCTGTTATTCACATAGAGAAAGTTGCAGGCGACAAAGTTGTGCGTGATGAGAAGAACAGGGTTAAGGAGGAGCTGACAGAACTATGTTTCTCAGATCCAATGGACCTCCATAGGAGGCTTGATCGTGAATTTCTGGAAACCGAGTCTGACTCGTTTAAGTTAAAGCTTCAGAAAGTTGTGGCAAGTCGTTTGGTTTTGCCAGATATTTGCAGGTCTTATATTGACATCATTGAAAGGCAGCTTGAAGTCAGCGATTTATCTATGTCTTCGCGTGTGCTGTTAATGCATCAAGTTACAGTTTGGGAGTTAATTAGGGTATTGTTCTCAGAAAGAGCAGCTGGTAACCAGTTGGAGCCTACTGGTGATGAGGATCAGGGCATGATTTTAGACAAGAAAGAAGGTTCTGTCAACATAGACCTTGAAGCACTTCCTTTGGTTAGGAGAGCAGACTTCAGCAATTGGTTACAGGACAGTGTCTGTCATCGGGTACAAGGAGAGGTGGGCTCGTTAAGTGATGCCAGATACTTGGAACATATTATTCTGCTTTTGACTGGTAGACAATTAGCCACAGCCACAGAAGTTGCTGCTTCAAGGGGCGATGTCCGGCTGGCAATCTTGCTAAGCCAGGCAGGTGGATCAATGTTAAATCGATCTGACGTTGCTCAGCAACTGGATATATGGAAAATAAATGGTCTGAATTTTGATTATATTGAGGAAGACAGGTTAAAGATATATGAGTTGCTTGCTGGTAACATACAAGGCGCTTTACTAGATTCACCAATCGATTGGAAAAGGTACTTTGGTTTAATCATGTGGTATCGATTATCACCTGATACATCACTCGATGTTGCCATTCATTCTTATCACCAATTACTTGTTGAGGGCAAAGTTCCATATCCTGTTCCTGTCTATATCGATGAAGGACCTCTTGATGAAGCACTTCAGTGGTCCCCCGGTGACCGTTTTGACATATCTTTTTATTTAATGCTTCTTCATGCCAATCAAGATGAGAAGTTTGGGCTGCTAAAAACCATGTTCAGTGCATTCTCATCTTCATATGATCCCTTGGACTACCATATGATCTGGCATCAGCGTTCTATCCTGGAAGCTATTGGTGCTTTCAGTGCAAATGATCTGCACATACTAGATTTGAGTTTTGTTTATCAATTGCTATGTCTTGGGAAGTGCCATTGGGCTATCTATGTCATTCTACATATTCCACATCTTGATGATGCCCCATACATCCATGAGAAGTTAATCAGGGAAATTTTGTCACAGTATTGTGAATTATGGAGTGAAGATGAAGCTCAGAGACAATATATTGCAGAACTTGGTATACCAGCAGAATGGATGCATGAGGCTCTGGCTCTTTATCATGAATACTATGGAGATCGGCAGGGTGCACTGGAGAATTTTATTCAGTGCAGCAATTGGAAGAAAGCTCATACTATTTTCATGACATCTGTTGCTCATTCTCTTTTTCTGTCATCAAACCATCAAGAGATCTGGGACATTACAAGTGCTTTGGAGAATCACAAGTCTGAAATTGCTGACTGGGACCTTGGTGCTGGAATATACATAGACTATTACATTCTGAGGAACTCTATGCAAGAAGAAAGTACCATGGATGATTCAGATCCACTTGAGAAGAAAAATGAATCATGCAGGAGTTTCTTTGGCCGATTAAATGACTCCTTGCTTATTTGGGGAAGCAAATTACCTGTTGAGGCGAGGTTTGTTCTAATTCTTGAGTATGGCAGGGCATGCTACTCGAAGATGGCGGAGGAGCTATGCGAGCTTCTAATGAACTCTCCCGGCGAGGGCTTGGCACCAAATCTCTACATGGGCTGCTTTCAGACGATGCTCAACGCCCCCGTCCCTGATGACCACAGGACGTCGTACCTGCAGGAGGCAGTCTCTGTTTTCACCGACATACTTTGCAGGGACTCGTGCTAG
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01000188G0820 gene.
ATAAAGAAAAGAAAACAATTGATGTTGATGATGATATTGTTTACTGATGATTAAGTATTGTTCATTGTTTATTATTATGCTTACTGAGTCGTGGACTCACCTTTGCTCCACTGTTGTTTTTAGATGACCGTTAACAATGTTGCTCATGGGAAGGGCTAGCACACGTGGAATCATGTCATTTACTCAATTACAAGGACTATTGATCATGAGATAATTCATTAGTATGATAAATTATAATTAGTAATAGATATTATTGCTTAGCTTTAGTTGTTTATTTATTAAATAGATTTGATTGGTTTGGTTATGCGTTGATCATTGTTATTATTTTGGCACGCTTCCTATGAATTATTTATCCATGTTTTCTTTATAGTTATCCTTGTGTTATTATGACCCGTGTACGGGTTTTTATCTTTGATATGCTTGCTATAATTTAGTGATAATTATTGTTAAAATTGTTAGCTAGGTTAGTTTAGTGGCATTCTGGGCTCCGTATTGGGTCGGGGTGTTACATGGGGCCCCGAGGGCCCTCGCCTTGGAACGCCTCACAGGAAGCGAGGGGTTCCGAGGGCCTTCGCTCTAGGGTCGCCTCGCGTGGAGCGAAGGGAGTCAGGGCCACTCATGGACCAAGAGCACATGCAAGGTAGATTAGGCTTAGGAGGGTCTATCATGCACCAGAGCCTACGCCTAGGAGGTGAAAAGACATGCAACCCCTAAAAGCGTATAACATTTAAGGATAGAATTGTAATCTCCTGTACCTTAAATGTAACACTATAAATATGCCATTTCCCCCATGTAATAAATAAGCCTTTTTAAGGCAATAAAGACACACCTTTTAACACTTCAATACTGTTTTCTCACCTTTGAGGATCTCGAGGGTTTCCCCTTCACATCTGCAGGGAACTCGGGGTTCCCGTTCCTCTATTGTCTAGTTTATAGCTACGACATTCATGGTTCTGTTGCTGTCTGTACGTTTGCACTTGTGTTTATGTAGCACTCAAACG
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01000188 Download
Protein sequence
Protein sequence
MAGDAMFPVLHSSDYFTRPLIDELVEREAADPGYCSRVPNFVVGRVRYGQVMFPGNTDVRGMDLNEIVRFDRHYVVVYEDEAGKPPVGHGLNKAAEVTLKLDLRKLPEPSILVELLRCRSKKQGARFLSFNPVNGRWKFEVDHFSRFGLVDEEEEDVVMDESVVRQPIAEVRDPPANGLELELSHSLPAHLGLDPAKMQEMRMAMFSNEEDDEYMEDGFPSDQRYLSRERMNVDSPNSSANGPRLRSLSPLHGSSQKIGRRPGILARKEPQALLEYSVNSSELGPSSQGILMSGQNKGFPVRMTKVEGFKLPAEQATPVAGKIYTNCVADAALFMGRSFRVGWGPNGILVHSGSLVNSPGNSLSSVIHIEKVAGDKVVRDEKNRVKEELTELCFSDPMDLHRRLDREFLETESDSFKLKLQKVVASRLVLPDICRSYIDIIERQLEVSDLSMSSRVLLMHQVTVWELIRVLFSERAAGNQLEPTGDEDQGMILDKKEGSVNIDLEALPLVRRADFSNWLQDSVCHRVQGEVGSLSDARYLEHIILLLTGRQLATATEVAASRGDVRLAILLSQAGGSMLNRSDVAQQLDIWKINGLNFDYIEEDRLKIYELLAGNIQGALLDSPIDWKRYFGLIMWYRLSPDTSLDVAIHSYHQLLVEGKVPYPVPVYIDEGPLDEALQWSPGDRFDISFYLMLLHANQDEKFGLLKTMFSAFSSSYDPLDYHMIWHQRSILEAIGAFSANDLHILDLSFVYQLLCLGKCHWAIYVILHIPHLDDAPYIHEKLIREILSQYCELWSEDEAQRQYIAELGIPAEWMHEALALYHEYYGDRQGALENFIQCSNWKKAHTIFMTSVAHSLFLSSNHQEIWDITSALENHKSEIADWDLGAGIYIDYYILRNSMQEESTMDDSDPLEKKNESCRSFFGRLNDSLLIWGSKLPVEARFVLILEYGRACYSKMAEELCELLMNSPGEGLAPNLYMGCFQTMLNAPVPDDHRTSYLQEAVSVFTDILCRDSC
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above