gene PH01000183G0940
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01000183:636550 - 647647(+ stand)   Name
Alternate name Locus tag PH01000183G0940
Length of gene 11098  bp Length of CDS 3864  bp
Product information
Feature type
CDS
Product name
START domain containing protein
Alternate name
Molecular weight
(predicted)
139541.35962  kDa
Isoeletric point
(predicted)
6.02937698364257
Length
1287  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
SNP ID Position Base in Scaffold Polymorphism
PH01SNP01296950 PH01000183:647555 G G_A
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_137066 9
Please click OG5_137066 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
Gene ID Short description Curator summary Computational description E-value
AT2G34710.1
Homeobox-leucine zipper family protein / lipid-binding START domain-containing protein
Dominant PHB mutations cause transformation of abaxial leaf fates into adaxial leaf fates. Encodes a member of HD-Zip family which contains homeodomain-leucine zipper domains and domain similar to a mammalian sterol binding domain. Has overlapping functio
PHABULOSA (PHB); CONTAINS InterPro DOMAIN/s: Homeobox (InterPro:IPR001356), Homeodomain-like (InterPro:IPR009057), Lipid-binding START (InterPro:IPR002913), MEKHLA (InterPro:IPR013978), Homeodomain-related (InterPro:IPR012287); BEST Arabidopsis thaliana p
0
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os12g41860.1 START domain containing protein, expressed 0
 
Function (determined by interpro in EMBL-EBI)
Protein family membership

None predicted.

Domains and repeats
  1. Domain
  2. Domain
1 200 400 600 800 1000 1287
Detailed signature matches
    1. SSF46689 (Homeodoma...)
    1. PF00046 (Homeobox)
    1. SM00234 (START)
    2. PS50848 (START)
    3. PF01852 (START)
    1. PF08670 (MEKHLA)
    1. PF04195 (Transposas...)
Unintegrated signatures no IPR
Unintegrated signatures
  1. PTHR24326 (FAMILY N...)
  2. SSF55961 (Bet v1-like)
GO term prediction

Biological Process

GO:0006355 regulation of transcription, DNA-dependent

Molecular Function

GO:0003677 DNA binding
GO:0003700 sequence-specific DNA binding transcription factor activity
GO:0043565 sequence-specific DNA binding

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
specific 176884 186 402 1.04E-66 cd08875 START_ArGLABRA2_like cl14643 -
superfamily 246681 186 402 1.04E-66 cl14643 SRPBCC superfamily - -
specific 238039 22 68 4.01E-06 cd00086 homeodomain cl00084 C
superfamily 241599 22 68 4.01E-06 cl00084 homeodomain superfamily - C
non-specific 216740 192 401 1.24E-51 pfam01852 START cl14643 -
non-specific 214575 192 397 4.51E-40 smart00234 START cl14643 -
non-specific 176851 230 376 9.44E-17 cd00177 START cl14643 -
non-specific 200956 22 68 4.27E-06 pfam00046 Homeobox cl00084 C
non-specific 197696 22 68 1.82E-05 smart00389 HOX cl00084 C
non-specific 176883 242 397 4.00E-05 cd08874 START_STARD9-like cl14643 N
non-specific 176877 239 377 6.29E-05 cd08868 START_STARD1_3_like cl14643 N
non-specific 176876 239 368 0.000108148 cd08867 START_STARD4_5_6-like cl14643 N
non-specific 112985 1011 1080 0.000321153 pfam04195 Transposase_28 cl04444 C
superfamily 112985 1011 1080 0.000321153 cl04444 Transposase_28 superfamily - C
specific 197664 97 148 0.000453807 smart00338 BRLZ cl02576 N
superfamily 243100 97 148 0.000453807 cl02576 B_zip1 superfamily - N
non-specific 176880 283 372 0.00137811 cd08871 START_STARD10-like cl14643 N
non-specific 176878 298 367 0.00328367 cd08869 START_RhoGAP cl14643 N
non-specific 176922 258 350 0.00473838 cd08914 START_STARD15-like cl14643 NC
non-specific 201054 97 140 0.00601614 pfam00170 bZIP_1 cl02576 N
multi-dom 219964 773 912 3.47E-55 pfam08670 MEKHLA - -
multi-dom 227863 19 128 0.00204905 COG5576 COG5576 - N
Conserved sites/feature
Type Brief name Coordinates Complete size Mapped size Source domain
specific putative lipid binding site M214,V215,S223,A238,A240,V251,L255,P259,Y262,R263,D264,C265,Q288,Y290,A291,P292,T293,A296,R299,F301,T303,E319,A340,V342,L343,P344,S345,Y347,I359,M361,D363,V365,L367,A369,R377,L379,Y380,E381,P383,K384,I385,Q388,K389,I392 44 44 176884
specific specific DNA base contacts K22,R25 6 2 238039
specific DNA binding site K22,Y23,V24,Y26,K43,R49,Q66,K68 18 8 238039
 
DNA sequence
Upstream 1000 bp region from PH01000183G0940 gene.
CCCAGCTCCACCCGGAAGCTTCCTCAACGACGGCGGTCACTGACTCATTGGTGAATGGCGCTCCTTCGGCGACGGTGCTCCACAGCAGGCCGAAGCTTCCTCGGCAGCCTTCGTAATCGTAGATGTGGTTCATGTGGATTGCAATTGGTGTTTTGTAGGCGTGGAGCCGTTGATGATGTTCTTCTTCAGATGATTTCGTGCTTTTCATGTTGGATCGATGTTTTTTTTTGCTAGTTCTTGCTTCTTTCACTGCAAACCAAAGCTGTTCTGATACTGAGACGACTAGAGGAGGAGCTCGATCGGGGAAGGGAGATGGGGAGGCCGGAGGCTGAGGGGAGGAGGAGCGCTGATGGGCGGTGGCCTTCTCTGTGTTGGCTGGAATAAGGAGGTGGTGCGACAGTTCATGCTGTGCCTCATGCTCGCGAGGGCTCGCGAGCCCGTTCGAGCCTACTGCCGAGCCAAACTGAGCGAGGTTTTTGGCTCGTTCCCAAAATGACTCGAGCCGACTGTTCATCCGAGCCGTAACGAGCCGACTTGGTTCGGCTCGTTTCCACCCCTACTATTACTGTCCTTAGGGGCATTTCAAATATTTTCCATCTCGAAAGCTGCAACCAGCCTACCTAAAAGGCAGACAATCAAACACCAAATCTTTTCTGACAGACTGAAAGCCAATTTTCAGGAAAACTATAGTTGTTCCAAACAGGCCCTACAACAACCCTGTACAGTCCCTATGATGCCATGGTCCTAATAAATCCACACACACTCTTAAAAAATAAATTCAGAAGCACTCTAGAAAAAAAAAAAGAAATTCAGGAAAGGAAATGTCTCATTCTCATGTGAAGAAAAAACTGAACACTCAAACGAGGAGATATCCTTAAAAAAAGAGGAGAGAGAGAGAAATTTTGTCTCCAAGAAAAATAGGGGGGGAAGGGGGGGAGTCCTCATGTGAAGACCAGAGCTATCACTAGTCTGCTACTGGTTGTCTGGTTGCTAGCTAGTGA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGGCGGCGGTGGGGAGCAAGGAGAAGCTCTCCCCGGGGGCGGCGCCGCAGGTGGACACGGGCAAGTACGTGCGGTACACGCCGGAGCAGGTGGAGGCACTGGAGCGCGTCTACACCGAGTGCCCCAAGCCCAGCTCGCTGCGCCGGCAGCACCTCATCAGGGAGTGCCCCATCCTCAGCAACATCGAGCCCAAGCAGATCAAGTTTGGAACTTTTGCTGTTGAAGGAGTTCTAATGGGTTGGATTGGTGGTAAGAAGGCTCGTTACTCGGATTTGCTTCTCAAAGGATGCCGGGAGAAGCAGCGCAAGGAGGCCTCCCGCCTGCAGACCGTGAACCGGAAGCTGACTGCGATGAACAAGCTGTTGATGGAGGAGAATGACCGGCTACAGAAGCAGGTGTCCCGTCTCGTCTACGAGAACGGCTACATGCGGAACCAACTCCACAATCCTTCTGTGGCCACCACAGACACAAGCTGTGAGTCTGTGGTGACGAGTGGTCAGCACCATCAACAGCAAAACCCAGCAGCACCGCATCCGCAAAGGGATGCGAACAACCCAGCTGGTCTGCTCGCTATTGCTGAGGAGACCTTGGCAGAGTTCTTGTCCAAGGCAACGGGAACTGCTGTCGAATGGGTGCAAATGGTTGGGATGAAGCCTGGTCCGGATTCCATTGGAATCATCGCTGTTTCGCACAATTGTAGTGGCGTAGCAGCACGAGCTTGCGGCCTTGTGAGCCTGGAGCCCACAAAGGTTGCGGAGATCCTCAAGGATCGCCCATCTTGGTATCGCGACTGCCGGTGCGTTGATATCCTCCATGTTATCCCTACGGGTAATGGTGGAACTATTGAGCTAATCTACATGCAGACTTATGCACCGACGACTTTGGCGGCACCACGCGACTTTTGGACACTCCGTTACACCAGTGGCCTTGAAGATGGCAGTCTTGTGATCTGTGAAAGGTCATTGACTCAGTCCACTGGCGGTCCATCAGGGCCTAACACTCCGAATTTTATCAGAGCCGAGGTGCTTCCTAGTGGTTATCTGATTCGACCATGCGAGGGAGGTGGCTCCATGATTCACATGGTGGATCATGTTGATTTGGATGCTTGGAGTGTGCCTGAGGTCCTTAGACCACTCTATGAATCTCCAAAGATCCTTGCGCAGAAGATGACCATTGCAGCATTGCGACACATTAGGCAAATTGCGCATGAATCAAGTGGTGAAATCCCCTATGGTGCTGGGCGCCAGCCTGCGGCTTGGAGTGTGCCTGAGGTCCTTAGACCACTCTATGAATCTCCAAAGATCCTTGCGCAGAAGATGACCATTGCAGCATTGCGACACATTAGGCAAATTGCGCATGAATCAAGTGGTGAAATCCCCTATGGTGCTGGGCGCCAGCCTGCGGTTCTCAGAACCTTCAGTCAAAGGCTCAGCAGAGGCTTCAACGATGCTGTGAGTGGATTTCCAGACGATGGTTGGTCTTTGTTGAGCAGTGATGGCGCTGAGGATATTACAATTTCAGTAAACTCATCTCCAAACAAGCTTATTGGATCCCATGTCAGCCCCTCCCCGCTCTTTTCTGCTATCGGGGTTGGCATCTTGTGTGCAAAGGCATCAATGCTGCTGCAGAATGTCCCACCTGCGCTACTTGTGCGATTTCTGAGGGAGCATCGCTCTGAATGGGCTGATCCTGGTGTTGATGCTTACTCTGCTGCCTCTTTGAGGGCCAGCCCATATGCAGTTCCAGGTTTAAGGGCTAGTGGGTTTATGGGCAGCCAGGTTATACTACCCCTTGCGCATACCTTGGAGCATGAAGAGTTCTTGGAGGTTATTAGGCTCGAAGGACATGGTTTTAGCCATGATGAGGTTCTTCTATCGCGGGATATGTATCTTCTTCAGCTTTGCAGCGGGGTTGATGAGAATGCTGCTGGTGCGTGCGCACAGCTTGTCTTTGCACCTATTGATGAATCTTTTGCTGATGATGCACCGCTGCTACCCTCAGGCTTCCGCGTGATACCACTGGATGCTAAGACGGATGTGCCATCCGCCACACGCACGCTTGACCTTGCTTCTGCCCTTGAGGTTGGATCAGGCGGAGCTTCGCGTGCTTTAAGTGATGCGTCCGGCACGTGCAACATGAGATCAGTCTTGACCATTGCCTTCCAGTTCTCATTTGAGAACCATCTTCGTGAAAGCGTGGCAGCAATGGCCAGGCAGTATGTCAGAGCTGTGATGGCATCTGTACAGAGGGTGGCCATGGCGATAGCTCCTTCTCGCCTGGGCTCACAGATCGAAATGAAGCACCCTCCAGGCTCTCCTGAGGCGCTTACACTTGCTAGCTGGATCGGCAGGAGTTATAGTACTGTCTCTGAAGTAGTTGACACTGGCGAAACTTTCAGGGTTCACACTGGAGGAGAGATCCATTGGTCGGACACTGAAGACGTGGACTCTCCCCTCAAGCTCCTGTGGAAACACAGCGATGCAATTCTCTGCTGTTCTCTGAAGGCTGCTCCTATGTTCACCTTTGCCAACAAAGCTGGCCTCGACATCCTGGAAACCACGCTGATCAACCTGCAGGACATTTCGCTTGAGACGATCCTGGATGACGAGGGCCGGAAGGCGCTGTGCTCAGAGTTCCCCAAGATCATGCAGCAGGGTTTCGCGTACCTCCCCGGTGGCGTGTGCAAGTCGAGCATGGGGAGGCAGGCGTCGTACGAGCAGGCGGTGGCGTGGAAGCCGGGTCTCCTCCGAACACCCTTCGAATGCTCTTTAAGCTTCCTTCGATTGTCACTTCGGAAGACCCTTCAGAGCCTTCGGGTCACCCTCCGGGTGCCTCTGGTACCCCTCGGGAGACTCTTCGAAGGCCTCGGGTCACCCTCGGGGTACCTTCTGTACCCCTCGGGAGAATCTTCGGAGCCTTCGGGTGAGGACTCCCTTCGGTGTGGCCGGGATGCTGCGGGTGAGACGGAGTATACTAGTGATTTGGGGAGGTCTACTGTTAGTAGGCTTTTTCTTGAGACGCTTGTGAGCGAGGGAAAGCTCGAGGATATTATGAAGGTCCGTGCTCCTGGGTCTGAGACGGTTCCACATCCTCGCGATGATGAAGCCATTGTTTTTGTTGCATTTTTGGATGCGGGGCTTCGGATTCCTTGTGTCGATCTAGTCTCCGAGGTGTTGCGATTGTACAGGGTGGAGCTTGCGCAACTGACGCCAAATTCTATTGTGAAACTTGGTGTGTTTGAGTGGATGTTGAGGTCTGCTGGCATTGCTGCCGAGGAGGTTGTGCCTGTGGCTGAAGCAGTGCGAGTTGCGGATGTTCTCCTCGGCCTGTATACTGGCGAGGAGCATTCGAGGCATCATCTGGTTGTGAGGGATCGTCGCCTGAATCGTGCTTATGATGTGTCGGTCGATTTGCCTGAGCGAGTCGACCCCGATGCTGGGAAGAAAAAACGTTCTCGCATGCCTGAGATTGAGGTCGGGGGACCTATTGCTGTGAAGCCTCTTCGTGTGGTCCGCCCTTCCGATGGCGGTGGTCCTTCGCGTCATTTGGAGGCTGCTGAGGAGCGGCCTAGTCGAGGACCCGTTCCAGACAAAGCGATCGGTACTATTCGTTATCCACGTCTTGATGCGACGGAGTCTTCCAGTGGTGGACTTCGGTCTCGTGGTGATGGTAGGAACCTCGAAGTCCCTGGTGATGCGCCTGCTACGTCAGAGGTGAATGTTGTTTCAAGCGGGGACGGTGGCAATGACGAGATCGCGGAGGCTTCCGAGGGTCGCGCGCCGATGGGTTCTGAGCCGGACCCTGCGGTCCTGCGCGCGATTCTCGGAAAAAGCCAGATTACCAAACACCAAAGTTTAACTTAA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01000183G0940 gene.
ATAAAGAGGACCTTAAAAGTATACTGCTTATAAGCTGTTTAAGAAAAAAAAGCTAGCTTTAAGTAATAAGCTAAAAAACCTAAACTCAAACAAATAAACAAACAAGGCCACAGATAGAGCTTCAGAGAAGCGTGGCCGTTAGTTTTCAGGTCAACCCATAATCTCAATTCACTCTAAAGCTAACGCGGTGCAATTTGAGACACTCACTGACAAAGATATGTCCTAGGCTGACTTGGTTGTTAATTAGCCACATGCATGGGGCAGTCCAAATTGAGTAACAATGGCTGTGTGCCAATGCAATCAATAATCAGTTAAAGCAAAAGATGCTCATCAGATGAGAATTGACATGGAGAGAGCAACCATCCAACTTGATCTTAGCTAGATTAGTAAGTTGTCATGATAACATTAGATTAGATGCAGCAAAAAAAGGACCAGGGTGTAGCTAGTTAGTTCCCCATTTTTGAAATAATCAATTATGTGCCACTGTAAAGATGTAGATTTTACAATTTATCACTGTATGTAGATGATATCTAGATTCTCGAGCCACATATCATCTACACATAAATAACAAATTATAAATTACAGATTTTTGACCATGACAAATAATCAGATCTTCCATCTTCAACTTATCTCTAACTTATCTGTCGTCTTCGTCTCAACGAAGGAATCAGGATTCAGGAATGTGTGCTTGGGCTTGGCTGCTTGCTTACCGAGTCCCAAACAGGAGTGCCGAGTCATTTCGCCATGCTCTCGCTCTCACCCCGACCCGTCGTCTCCTCCTTCCTCCTCAAACCCAAGCCCCGCCTCCTCCCCAAACTCATCTCCTCCGCCCTCGCCCTGACGCCGCCGAACCCCCAAAACCCTAGCCCGGACCCGGACCCGGACCCCACGCCACTCTTCCTCCGCCCGCCGGTGCACCAGGTCCCGGCTGCCTCCCTCGCTGCCTTCCGCCGTCGGGCGGCCGCGCTCATCCCGCCCTCCGCGCCGCACCTTCATCGCCA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01000183 Download
Protein sequence
Protein sequence
MAAVGSKEKLSPGAAPQVDTGKYVRYTPEQVEALERVYTECPKPSSLRRQHLIRECPILSNIEPKQIKFGTFAVEGVLMGWIGGKKARYSDLLLKGCREKQRKEASRLQTVNRKLTAMNKLLMEENDRLQKQVSRLVYENGYMRNQLHNPSVATTDTSCESVVTSGQHHQQQNPAAPHPQRDANNPAGLLAIAEETLAEFLSKATGTAVEWVQMVGMKPGPDSIGIIAVSHNCSGVAARACGLVSLEPTKVAEILKDRPSWYRDCRCVDILHVIPTGNGGTIELIYMQTYAPTTLAAPRDFWTLRYTSGLEDGSLVICERSLTQSTGGPSGPNTPNFIRAEVLPSGYLIRPCEGGGSMIHMVDHVDLDAWSVPEVLRPLYESPKILAQKMTIAALRHIRQIAHESSGEIPYGAGRQPAAWSVPEVLRPLYESPKILAQKMTIAALRHIRQIAHESSGEIPYGAGRQPAVLRTFSQRLSRGFNDAVSGFPDDGWSLLSSDGAEDITISVNSSPNKLIGSHVSPSPLFSAIGVGILCAKASMLLQNVPPALLVRFLREHRSEWADPGVDAYSAASLRASPYAVPGLRASGFMGSQVILPLAHTLEHEEFLEVIRLEGHGFSHDEVLLSRDMYLLQLCSGVDENAAGACAQLVFAPIDESFADDAPLLPSGFRVIPLDAKTDVPSATRTLDLASALEVGSGGASRALSDASGTCNMRSVLTIAFQFSFENHLRESVAAMARQYVRAVMASVQRVAMAIAPSRLGSQIEMKHPPGSPEALTLASWIGRSYSTVSEVVDTGETFRVHTGGEIHWSDTEDVDSPLKLLWKHSDAILCCSLKAAPMFTFANKAGLDILETTLINLQDISLETILDDEGRKALCSEFPKIMQQGFAYLPGGVCKSSMGRQASYEQAVAWKPGLLRTPFECSLSFLRLSLRKTLQSLRVTLRVPLVPLGRLFEGLGSPSGYLLYPSGESSEPSGEDSLRCGRDAAGETEYTSDLGRSTVSRLFLETLVSEGKLEDIMKVRAPGSETVPHPRDDEAIVFVAFLDAGLRIPCVDLVSEVLRLYRVELAQLTPNSIVKLGVFEWMLRSAGIAAEEVVPVAEAVRVADVLLGLYTGEEHSRHHLVVRDRRLNRAYDVSVDLPERVDPDAGKKKRSRMPEIEVGGPIAVKPLRVVRPSDGGGPSRHLEAAEERPSRGPVPDKAIGTIRYPRLDATESSSGGLRSRGDGRNLEVPGDAPATSEVNVVSSGDGGNDEIAEASEGRAPMGSEPDPAVLRAILGKSQITKHQSLT
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above