gene PH01000174G0590
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01000174:385632 - 391120(- stand)   Name
Alternate name Locus tag PH01000174G0590
Length of gene 5489  bp Length of CDS 1029  bp
Product information
Feature type
CDS
Product name
heat stress transcription factor
Alternate name
Molecular weight
(predicted)
38500.10062  kDa
Isoeletric point
(predicted)
5.31715774536132
Length
342  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
SNP ID Position Base in Scaffold Polymorphism
PH01SNP01252860 PH01000174:388399 C C_T
PH01SNP01252870 PH01000174:388551 G G_A
PH01SNP01252880 PH01000174:388561 A A_G
PH01SNP01252890 PH01000174:388627 C C_T
PH01SNP01252900 PH01000174:388656 C C_T
PH01SNP01252910 PH01000174:388787 C C_T
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_156059 9
Please click OG5_156059 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
Gene ID Short description Curator summary Computational description E-value
AT3G22830.1
heat shock transcription factor A6B
member of Heat Stress Transcription Factor (Hsf) family
heat shock transcription factor A6B (HSFA6B); FUNCTIONS IN: DNA binding, sequence-specific DNA binding transcription factor activity; INVOLVED IN: regulation of transcription, DNA-dependent; LOCATED IN: nucleus; EXPRESSED IN: root; CONTAINS InterPro DOMA
8E-106
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os03g58160.1 heat stress transcription factor, putative, expressed 0
 
Function (determined by interpro in EMBL-EBI)
Protein family membership

None predicted.

Domains and repeats
1 50 100 150 200 250 300 342
Detailed signature matches
    1. SM00415 (HSF)
    2. PF00447 (HSF_DNA-bind)
    3. PS00434 (HSF_DOMAIN)
    4. PR00056 (HSFDOMAIN)
Unintegrated signatures no IPR
Unintegrated signatures
  1. PTHR10015 (HEAT SHO...)
  2. PTHR10015:SF7 (HEAT...)
  3. SSF46785 ("Winged h...)
GO term prediction

Biological Process

GO:0006355 regulation of transcription, DNA-dependent

Molecular Function

GO:0003700 sequence-specific DNA binding transcription factor activity
GO:0043565 sequence-specific DNA binding

Cellular Component

GO:0005634 nucleus

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
specific 215924 39 132 4.54E-54 pfam00447 HSF_DNA-bind cl12113 -
superfamily 245876 39 132 4.54E-54 cl12113 HSF_DNA-bind superfamily - -
non-specific 214654 36 129 2.68E-52 smart00415 HSF cl12113 -
multi-dom 227497 37 132 7.56E-29 COG5169 HSF1 - C
multi-dom 224117 152 241 0.00177164 COG1196 Smc - NC
multi-dom 130902 152 240 0.00743819 TIGR01843 type_I_hlyD - NC
Conserved sites/feature
(0 result)
Type Brief name Coordinates Complete size Mapped size Source domain
 
DNA sequence
Upstream 1000 bp region from PH01000174G0590 gene.
ATGTTAACAAGACTAGTACATATTTAGTTCTTACAGAGCAATAGAGCATGATACGACACAAAGGGAAATAGTCTAGTAATTAATCATCAGGCAGGATTGGATTGGGTTATGAAACAAGAAATTAGCCATTGATGAATCAATCGATCAGCAGAGCAACAGTAACACCAATCTAACCCTACGACACGAGCATCGCATTTTATGACAGATCATATCCACACCAATCGCTCCATGCTCGCATATGATGCTGAAGCACCGGACGTGTAGATCATAGGAGCACACCACGGGGAGAATCTATCCTCACCTGGGGAGGAGGGGGCTCTGGTCGTGGGACGAGTAGGCCATCGTGGCGCTGCCGAGGCTGACGGTGACCGCGCCGTGGCGCGCCTCCCGGAACCGGTCGGCGAGCCCCGCTGCGCCCGGTTGCCGGAGCCCCTCCGGGCTCGGCGCCACCGCCCGGTCGAACACCGCCAGCATCTCGCCACCCGCGCCCCTGCGAATTTGGCCCGGGTCACGCCGCAACGAAGCCCGAATCCGCGCCTCCTCGTACGCTTCGATCCTCTACGCGCCGCGCGAGTCTAAAACCGCAGGTGTTTCTGGGATAAGGAGAGGAATGATCTCTCCTCTTATTATAGTACACTGCTACTGTAGCAGCGGCTTTACGTGGCCGCACCGTACGGACGATGGATCGACCTTCGGTCAGCGCGCGCGCGCGCGGGGAATGCGGGATAAGGATCGAGACGAATCCACACGGCGCTACACCTGTCATGAGTGACCACCGACCGCGCCGCACTGTTCGGACACCGAGAGGATAGAGCTGAAAGAAGAAGAAAAATGGAAAGTGGAGAGTGATCGTGGATGCCCAATTCTGTTACTACGTGGCCTATGTACGTACCATGATACCACCACTGATATGGCCCAGCGAAAAACCCTGTCTTGTTGACTGCCCCTCTCTCAAATAATAAAAAAGTTGTCTTGCTGACAGTAGGGTTTTCAAAACCGGT
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGAACCACCGGATGATGATGGATCCGGTGAAGGTGGAGAGCCGCCCCTCGATGAGTGGCGCGGCCAACGGCCCGCCGAGGCCGATGGACGGGCTCACCGACGCCGGCCCGCCGCCGTTCCTCACCAAGACGTACGACATGGTCGATGATCCCACCACGGACGCCGTCGTGTCGTGGGGCGCCACCAACAACAGCTTCGTGGTGTGGGATCCGCACATCTTTGGGACCGTGCTGCTGCCAAGGTACTTCAAGCACAACAACTTCTCCAGCTTCGTCCGGCAGCTCAACACCTATGGCTTCAGAAAGGTGGATCCTGACAGGTGGGAATTTGCTAATGAGGGCTTTCTGAGAGGACAGAGGCACCTTCTCAAAAACATTAAGCGTCGGAAACCTCCACATGCAACTCCAAATCAGCAATCTCCTGGCTCCTACCTTGAGGTAGGGCACTTTGGATATGATGGTGAGGTCGATCAGTTGAAGAGGGACAAGCAGCTCTTGATGGCTGAAGTGGTGAAGCTCAGGCAGGAGCAGCAAAACACGAGGTCAGATCTGCAAGCCATGGAAGAGAAGCTGCAAGGGACTGAGCAGAAGCAACAGCAGATGATGGCATTCTTGGCACGAGTCATGCAGAATCCTGAGTTCATACGCCAGCTGATCTCCCAGAGTGAGATGAGGAAGGAGCTCGAAGATGCCATCTCAAAGAAAAGAAGGCGCCGCATCGATCAGGGACCTGAAGCTGTTGATACCATGGGCTCTAGCTCTAGCCTGGAGCAAGGGTCACAGGTGTTGTTTGAACCCCAGGAGCCAGCGGATTCACTTCTCAATAGCAGTCCATCTGATCTGGAGAGTTCATCTGTCGAGACCAAGGGATTCGAGGTGCAACAAGGTGTTGCTTCCAGCAGCTCTCAACGAGCGAAGGGCAAAACCAACGGAGAGTTAAACGATGATTTCTGGGAGGACCTGCTGCACGAAGGGGGGCTCGGTGACGAGGCTGGCAACCCCGTCGTTCAGGATGATATTTTGGGTTAG
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01000174G0590 gene.
GGACCTTTGTTCCCTCCCAAGACTTTTATCTTTAGTCTTCTATTTTTCTTGAGATGAATATTGTAGGTTTTCTGTTGCTTATGTTGATTTGTGCATGATACTGATGACACTTTTGGTGCGTAGATCTTTTTCCCATTGGGCAAGGTCTCTGTCATGATACATGGTGGACTCGACTGGCATCGCTCATCTTCTGTGGCTACATCATCTATGTATGACACGGACAATATCATCAAGCGCTACTCATGCGATGAGTACATCTGGGCTGCAGTGTCGCTCTACCTCGACGTCATCAACCTCTTCCTGAATCTATTATTATCCCTACCGAGGGCAGCTGATTGCTGAGCGCATCCAAGCCTGTGCTAATCTAGTTCTCTAGCTTGTGCATATCATAAATTCCTGAATGTTCACGGATCCCTGTACCTTGATTGCCAGCAAATTCTGTCGATACTCCGCAAATGCTATTTGATAAGCGCAGACTTCTACGGAACCACATAAAGCTGTTTACCAGTTTTTGGATACGTGCAATGTTGCCTTATTTCTTTGCACATTCAAAATATGAATGCTAGTGAGTTACAGTGTGTAGAACACGTAAATTTATAATTCCCTACTGTTGAAGACACCTGTTCAGGCTTGCTAACCAGCACCGGTGCACCATCCTGCATGCGCAGAACTTGTCCAGTTTTTTGGTTTTCGCAAAATGAACTGGACACATTATGCCGAATTTTTTTCATTTATGGCTCCTTGATTTTCTGTATTTTCAAAACTAATCCTCTTCCGCCGTAATTTACACATTTAGCCTCTATACAGTGCTCCCACCGTAGTTCCCAGGGGCGGCAGGCTGCCTGGCCCCGATAAAATTCCAGAAAAATTGCAGAAAAGGGAAATAAAATTAAAAAAATTCCAAAATTTTAAAAAAAATTACATCAAAATCCAATAAGCTTATTGAATTTAATAAAATATTATTACAATTAAGCTTTAATTAATCCAATAAAATAGAAATT
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01000174 Download
Protein sequence
Protein sequence
MNHRMMMDPVKVESRPSMSGAANGPPRPMDGLTDAGPPPFLTKTYDMVDDPTTDAVVSWGATNNSFVVWDPHIFGTVLLPRYFKHNNFSSFVRQLNTYGFRKVDPDRWEFANEGFLRGQRHLLKNIKRRKPPHATPNQQSPGSYLEVGHFGYDGEVDQLKRDKQLLMAEVVKLRQEQQNTRSDLQAMEEKLQGTEQKQQQMMAFLARVMQNPEFIRQLISQSEMRKELEDAISKKRRRRIDQGPEAVDTMGSSSSLEQGSQVLFEPQEPADSLLNSSPSDLESSSVETKGFEVQQGVASSSSQRAKGKTNGELNDDFWEDLLHEGGLGDEAGNPVVQDDILG
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above