gene PH01000169G0700
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01000169:470609 - 473853(+ stand)   Name
Alternate name Locus tag PH01000169G0700
Length of gene 3245  bp Length of CDS 2238  bp
Product information
Feature type
CDS
Product name
multidrug resistance protein
Alternate name
ABCB1
Molecular weight
(predicted)
81396.0163200002  kDa
Isoeletric point
(predicted)
8.25965499877929
Length
745  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
(0 result)
SNP ID Position Base in Scaffold Polymorphism
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_126596 35
Please click OG5_126596 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
Gene ID Short description Curator summary Computational description E-value
AT3G28345.1
ABC transporter family protein
ABC transporter family protein; FUNCTIONS IN: ATPase activity, coupled to transmembrane movement of substances; INVOLVED IN: transport, transmembrane transport; LOCATED IN: plasma membrane; EXPRESSED IN: shoot apex, inflorescence meristem, cotyledon, hypo
0
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os02g09720.1 multidrug resistance protein, putative, expressed 0
 
Function (determined by interpro in EMBL-EBI)
Protein family membership

None predicted.

Domains and repeats
Detailed signature matches
    1. SSF52540 (P-loop co...)
    1. SSF90123 (ABC trans...)
    1. PS50929 (ABC_TM1F)
    1. PF00664 (ABC_membrane)
    1. SM00382 (AAA)
    1. PF00005 (ABC_tran)
    2. PS50893 (ABC_TRANSP...)
    1. PS00211 (ABC_TRANSP...)
Unintegrated signatures no IPR
Unintegrated signatures
  1. PTHR24221 (FAMILY N...)
GO term prediction

Biological Process

GO:0006810 transport
GO:0055085 transmembrane transport

Molecular Function

GO:0000166 nucleotide binding
GO:0005524 ATP binding
GO:0016887 ATPase activity
GO:0017111 nucleoside-triphosphatase activity
GO:0042626 ATPase activity, coupled to transmembrane movement of substances

Cellular Component

GO:0016021 integral to membrane

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
specific 213216 500 739 1.13E-138 cd03249 ABC_MTABC3_MDL1_MDL2 cl17201 -
superfamily 247755 500 739 1.13E-138 cl17201 ABC_ATPase superfamily - -
non-specific 213218 500 735 1.79E-108 cd03251 ABCC_MsbA cl17201 -
non-specific 213220 505 739 5.31E-101 cd03253 ABCC_ATM1_transporter cl17201 -
non-specific 213221 498 727 3.39E-93 cd03254 ABCC_Glucan_exporter_like cl17201 -
non-specific 213215 493 714 7.48E-82 cd03248 ABCC_TAP cl17201 -
non-specific 213195 500 712 4.50E-74 cd03228 ABCC_MRP_Like cl17201 -
non-specific 213219 500 739 1.39E-71 cd03252 ABCC_Hemolysin cl17201 -
non-specific 213212 498 718 1.93E-67 cd03245 ABCC_bacteriocin_exporters cl17201 -
non-specific 213211 498 719 4.99E-60 cd03244 ABCC_MRP_domain2 cl17201 -
non-specific 213216 1 100 9.58E-53 cd03249 ABC_MTABC3_MDL1_MDL2 cl17201 N
superfamily 247755 1 100 9.58E-53 cl17201 ABC_ATPase superfamily - N
non-specific 213213 502 714 1.37E-46 cd03246 ABCC_Protease_Secretion cl17201 -
non-specific 213218 1 96 1.56E-43 cd03251 ABCC_MsbA cl17201 N
non-specific 213269 498 719 2.81E-43 cd03369 ABCC_NFT1 cl17201 -
non-specific 213227 500 718 7.83E-43 cd03260 ABC_PstB_phosphate_transporter cl17201 -
non-specific 213225 514 719 2.51E-41 cd03258 ABC_MetN_methionine_transporter cl17201 -
non-specific 213192 502 712 9.92E-41 cd03225 ABC_cobalt_CbiO_domain1 cl17201 -
non-specific 213214 502 718 3.78E-39 cd03247 ABCC_cytochrome_bd cl17201 -
non-specific 213220 1 96 1.39E-38 cd03253 ABCC_ATM1_transporter cl17201 N
non-specific 213228 500 719 1.54E-37 cd03261 ABC_Org_Solvent_Resistant cl17201 -
non-specific 213196 514 712 6.61E-37 cd03229 ABC_Class3 cl17201 -
non-specific 213222 500 695 1.19E-36 cd03255 ABC_MJ0796_LolCDE_FtsE cl17201 -
non-specific 213226 500 718 2.20E-36 cd03259 ABC_Carb_Solutes_like cl17201 -
non-specific 213217 500 712 3.83E-35 cd03250 ABCC_MRP_domain1 cl17201 -
non-specific 213221 1 86 2.54E-34 cd03254 ABCC_Glucan_exporter_like cl17201 N
non-specific 213195 2 75 6.87E-34 cd03228 ABCC_MRP_Like cl17201 N
non-specific 213260 500 695 3.07E-33 cd03293 ABC_NrtD_SsuB_transporters cl17201 -
non-specific 213219 1 100 8.61E-33 cd03252 ABCC_Hemolysin cl17201 N
non-specific 213229 517 695 1.30E-32 cd03262 ABC_HisP_GlnQ cl17201 -
non-specific 213224 500 718 2.64E-32 cd03257 ABC_NikE_OppD_transporters cl17201 -
non-specific 213261 522 719 8.42E-32 cd03294 ABC_Pro_Gly_Betaine cl17201 -
non-specific 213255 496 740 1.73E-31 cd03288 ABCC_SUR2 cl17201 -
non-specific 213262 500 729 1.91E-31 cd03295 ABC_OpuCA_Osmoprotection cl17201 -
non-specific 213181 501 718 2.28E-31 cd03214 ABC_Iron-Siderophores_B12_Hemin cl17201 -
non-specific 213197 500 714 7.85E-31 cd03230 ABC_DR_subfamily_A cl17201 -
non-specific 213267 514 719 1.82E-30 cd03300 ABC_PotA_N cl17201 -
non-specific 213223 502 723 3.04E-30 cd03256 ABC_PhnC_transporter cl17201 -
non-specific 213264 518 718 5.67E-30 cd03297 ABC_ModC_molybdenum_transporter cl17201 -
specific 216049 178 448 4.92E-29 pfam00664 ABC_membrane cl18356 -
superfamily 216049 178 448 4.92E-29 cl18356 ABC_membrane superfamily - -
non-specific 213202 502 714 1.45E-27 cd03235 ABC_Metallic_Cations cl17201 -
non-specific 213231 500 718 2.45E-27 cd03264 ABC_drug_resistance_like cl17201 -
non-specific 213266 519 719 4.06E-27 cd03299 ABC_ModC_like cl17201 -
non-specific 213263 522 719 4.41E-27 cd03296 ABC_CysA_sulfate_importer cl17201 -
non-specific 213230 509 719 7.87E-27 cd03263 ABC_subfamily_A cl17201 -
non-specific 213180 517 718 1.86E-26 cd03213 ABCG_EPDR cl17201 -
non-specific 213268 514 718 1.51E-25 cd03301 ABC_MalK_N cl17201 -
non-specific 213259 509 694 1.94E-25 cd03292 ABC_FtsE_transporter cl17201 -
non-specific 213191 517 725 3.48E-25 cd03224 ABC_TM1139_LivF_branched cl17201 -
non-specific 213186 519 719 1.77E-24 cd03219 ABC_Mj1267_LivG_branched cl17201 -
non-specific 213233 519 718 8.96E-24 cd03266 ABC_NatA_sodium_exporter cl17201 -
non-specific 213211 2 81 1.37E-23 cd03244 ABCC_MRP_domain2 cl17201 N
non-specific 213215 1 76 1.60E-23 cd03248 ABCC_TAP cl17201 N
non-specific 213193 501 709 4.41E-23 cd03226 ABC_cobalt_CbiO_domain2 cl17201 -
non-specific 213213 2 76 6.23E-23 cd03246 ABCC_Protease_Secretion cl17201 N
non-specific 213256 517 714 3.68E-22 cd03289 ABCC_CFTR2 cl17201 C
non-specific 213258 517 723 8.20E-21 cd03291 ABCC_CFTR1 cl17201 -
non-specific 213265 512 718 9.87E-21 cd03298 ABC_ThiQ_thiamine_transporter cl17201 -
non-specific 213183 514 715 1.19E-20 cd03216 ABC_Carb_Monos_I cl17201 -
non-specific 213201 514 718 3.83E-19 cd03234 ABCG_White cl17201 -
non-specific 213212 1 76 5.21E-19 cd03245 ABCC_bacteriocin_exporters cl17201 N
non-specific 213179 1 75 6.49E-19 cd00267 ABC_ATPase cl17201 N
non-specific 213179 638 712 7.53E-19 cd00267 ABC_ATPase cl17201 N
non-specific 213225 1 88 9.11E-19 cd03258 ABC_MetN_methionine_transporter cl17201 N
non-specific 213236 514 718 1.62E-18 cd03269 ABC_putative_ATPase cl17201 -
non-specific 213257 522 712 1.84E-18 cd03290 ABCC_SUR1_N cl17201 -
non-specific 213185 517 670 3.97E-18 cd03218 ABC_YhbG cl17201 C
non-specific 213187 514 718 1.49E-17 cd03220 ABC_KpsT_Wzt cl17201 -
non-specific 213255 2 98 1.70E-17 cd03288 ABCC_SUR2 cl17201 N
non-specific 213269 1 81 2.30E-17 cd03369 ABCC_NFT1 cl17201 N
non-specific 213222 1 76 4.51E-17 cd03255 ABC_MJ0796_LolCDE_FtsE cl17201 N
non-specific 213196 2 75 5.09E-17 cd03229 ABC_Class3 cl17201 N
non-specific 213224 1 80 1.00E-16 cd03257 ABC_NikE_OppD_transporters cl17201 N
non-specific 213227 1 85 1.29E-16 cd03260 ABC_PstB_phosphate_transporter cl17201 N
non-specific 213179 502 583 2.67E-16 cd00267 ABC_ATPase cl17201 C
non-specific 213235 519 718 3.73E-16 cd03268 ABC_BcrA_bacitracin_resist cl17201 -
non-specific 213197 1 76 5.86E-16 cd03230 ABC_DR_subfamily_A cl17201 N
non-specific 213229 1 76 7.66E-16 cd03262 ABC_HisP_GlnQ cl17201 N
non-specific 213226 1 80 1.64E-15 cd03259 ABC_Carb_Solutes_like cl17201 N
non-specific 213217 1 75 2.72E-15 cd03250 ABCC_MRP_domain1 cl17201 N
non-specific 213261 1 88 4.32E-15 cd03294 ABC_Pro_Gly_Betaine cl17201 N
non-specific 213192 2 75 5.10E-15 cd03225 ABC_cobalt_CbiO_domain1 cl17201 N
non-specific 213183 1 76 5.25E-15 cd03216 ABC_Carb_Monos_I cl17201 N
non-specific 213232 519 719 5.27E-15 cd03265 ABC_DrrA cl17201 -
non-specific 213184 517 718 6.36E-15 cd03217 ABC_FeS_Assembly cl17201 -
non-specific 213267 1 85 7.17E-15 cd03300 ABC_PotA_N cl17201 N
non-specific 213202 1 65 1.52E-14 cd03235 ABC_Metallic_Cations cl17201 N
non-specific 213190 522 696 2.47E-14 cd03223 ABCD_peroxisomal_ALDP cl17201 -
non-specific 213199 525 712 2.92E-14 cd03232 ABCG_PDR_domain2 cl17201 -
non-specific 213223 1 76 2.94E-14 cd03256 ABC_PhnC_transporter cl17201 N
non-specific 213214 2 80 3.31E-14 cd03247 ABCC_cytochrome_bd cl17201 N
non-specific 213266 1 88 3.66E-14 cd03299 ABC_ModC_like cl17201 N
non-specific 213190 2 58 5.23E-14 cd03223 ABCD_peroxisomal_ALDP cl17201 N
non-specific 213262 1 88 6.46E-13 cd03295 ABC_OpuCA_Osmoprotection cl17201 N
non-specific 213186 1 90 1.29E-12 cd03219 ABC_Mj1267_LivG_branched cl17201 N
non-specific 213228 2 90 1.41E-12 cd03261 ABC_Org_Solvent_Resistant cl17201 N
non-specific 213268 1 80 1.91E-12 cd03301 ABC_MalK_N cl17201 N
non-specific 213264 1 76 2.21E-12 cd03297 ABC_ModC_molybdenum_transporter cl17201 N
non-specific 213200 517 691 2.54E-12 cd03233 ABCG_PDR_domain1 cl17201 -
non-specific 213263 1 88 2.87E-12 cd03296 ABC_CysA_sulfate_importer cl17201 N
non-specific 213193 2 77 6.33E-12 cd03226 ABC_cobalt_CbiO_domain2 cl17201 N
non-specific 213181 1 80 7.14E-12 cd03214 ABC_Iron-Siderophores_B12_Hemin cl17201 N
non-specific 213182 518 712 8.09E-12 cd03215 ABC_Carb_Monos_II cl17201 -
non-specific 213180 2 61 1.46E-11 cd03213 ABCG_EPDR cl17201 N
non-specific 213260 1 78 2.35E-11 cd03293 ABC_NrtD_SsuB_transporters cl17201 N
non-specific 213231 2 80 2.44E-11 cd03264 ABC_drug_resistance_like cl17201 N
non-specific 213191 1 88 2.52E-11 cd03224 ABC_TM1139_LivF_branched cl17201 N
non-specific 213233 1 76 3.96E-11 cd03266 ABC_NatA_sodium_exporter cl17201 N
non-specific 213230 1 85 2.29E-10 cd03263 ABC_subfamily_A cl17201 N
non-specific 213259 1 67 2.52E-10 cd03292 ABC_FtsE_transporter cl17201 N
non-specific 213198 511 681 4.34E-10 cd03231 ABC_CcmA_heme_exporter cl17201 -
non-specific 213188 638 712 4.71E-10 cd03221 ABCF_EF-3 cl17201 N
non-specific 213204 520 695 7.45E-10 cd03237 ABC_RNaseL_inhibitor_domain2 cl17201 C
non-specific 213188 1 57 5.49E-09 cd03221 ABCF_EF-3 cl17201 N
non-specific 213257 1 74 1.82E-08 cd03290 ABCC_SUR1_N cl17201 N
non-specific 213256 1 87 3.25E-08 cd03289 ABCC_CFTR2 cl17201 N
non-specific 213235 2 76 4.60E-08 cd03268 ABC_BcrA_bacitracin_resist cl17201 N
non-specific 213234 506 718 5.89E-08 cd03267 ABC_NatA_like cl17201 -
non-specific 213182 2 76 7.08E-08 cd03215 ABC_Carb_Monos_II cl17201 N
non-specific 213236 1 62 7.68E-08 cd03269 ABC_putative_ATPase cl17201 N
non-specific 213189 637 700 1.14E-07 cd03222 ABC_RNaseL_inhibitor cl17201 NC
non-specific 213232 2 85 4.26E-07 cd03265 ABC_DrrA cl17201 N
non-specific 213258 1 99 4.63E-07 cd03291 ABCC_CFTR1 cl17201 N
non-specific 213201 2 76 5.57E-07 cd03234 ABCG_White cl17201 N
non-specific 213265 1 63 1.18E-06 cd03298 ABC_ThiQ_thiamine_transporter cl17201 N
non-specific 213203 518 698 1.69E-06 cd03236 ABC_RNaseL_inhibitor_domain1 cl17201 C
non-specific 213188 500 569 1.75E-06 cd03221 ABCF_EF-3 cl17201 C
non-specific 213184 2 81 3.58E-06 cd03217 ABC_FeS_Assembly cl17201 N
non-specific 213238 519 706 1.11E-05 cd03271 ABC_UvrA_II cl17201 -
non-specific 213185 2 90 1.28E-05 cd03218 ABC_YhbG cl17201 N
non-specific 213187 2 80 1.35E-05 cd03220 ABC_KpsT_Wzt cl17201 N
non-specific 213189 1 62 3.84E-05 cd03222 ABC_RNaseL_inhibitor cl17201 NC
non-specific 213205 519 706 5.99E-05 cd03238 ABC_UvrA cl17201 -
non-specific 213238 1 68 0.000102563 cd03271 ABC_UvrA_II cl17201 N
non-specific 213203 1 60 0.0002035 cd03236 ABC_RNaseL_inhibitor_domain1 cl17201 NC
non-specific 213204 1 57 0.000572353 cd03237 ABC_RNaseL_inhibitor_domain2 cl17201 NC
non-specific 213234 1 62 0.00072324 cd03267 ABC_NatA_like cl17201 N
non-specific 213200 2 54 0.00106025 cd03233 ABCG_PDR_domain1 cl17201 N
non-specific 213198 1 43 0.00128914 cd03231 ABC_CcmA_heme_exporter cl17201 N
non-specific 213205 1 68 0.00239083 cd03238 ABC_UvrA cl17201 N
non-specific 213239 638 677 0.00294352 cd03272 ABC_SMC3_euk cl17201 N
non-specific 206747 528 545 0.00474931 cd01854 YjeQ_EngC cl17249 NC
superfamily 247803 528 545 0.00474931 cl17249 YlqF_related_GTPase superfamily - NC
multi-dom 224055 164 742 2.84E-122 COG1132 MdlB - -
multi-dom 233209 165 736 1.49E-117 TIGR00958 3a01208 - N
multi-dom 131259 219 739 1.99E-115 TIGR02204 MsbA_rel - -
multi-dom 131258 162 739 4.81E-101 TIGR02203 MsbA_lipidA - -
multi-dom 225183 221 739 2.39E-95 COG2274 SunT - N
multi-dom 183016 458 742 4.76E-83 PRK11176 PRK11176 - N
multi-dom 184214 472 727 5.26E-81 PRK13657 PRK13657 - N
multi-dom 227590 498 735 4.37E-76 COG5265 ATM1 - N
multi-dom 163508 256 737 4.33E-70 TIGR03796 NHLM_micro_ABC1 - N
multi-dom 233596 364 741 1.05E-69 TIGR01846 type_I_sec_HlyB - N
multi-dom 234189 275 726 3.29E-69 TIGR03375 type_I_sec_LssB - N
multi-dom 227321 425 743 1.50E-62 COG4988 CydD - N
multi-dom 234033 462 709 5.99E-62 TIGR02857 CydD - N
multi-dom 240339 160 740 8.48E-61 PTZ00265 PTZ00265 - C
multi-dom 236870 522 727 2.74E-60 PRK11174 PRK11174 - N
multi-dom 227320 479 725 4.67E-58 COG4987 CydC - N
multi-dom 130260 498 742 6.07E-58 TIGR01192 chvA - N
multi-dom 236865 488 735 1.71E-57 PRK11160 PRK11160 - N
multi-dom 234357 299 739 1.10E-55 TIGR03797 NHLM_micro_ABC2 - N
multi-dom 182732 498 732 1.38E-51 PRK10789 PRK10789 - N
multi-dom 226969 484 726 9.72E-50 COG4618 ArpD - N
multi-dom 182733 498 744 2.41E-49 PRK10790 PRK10790 - N
multi-dom 240339 1 553 3.99E-49 PTZ00265 PTZ00265 - N
multi-dom 200134 485 726 4.28E-49 TIGR01842 type_I_sec_PrtD - N
multi-dom 234041 289 697 1.03E-47 TIGR02868 CydC - N
multi-dom 224058 500 719 8.97E-45 COG1135 AbcC - C
multi-dom 215595 1 729 9.61E-45 PLN03130 PLN03130 - N
multi-dom 215640 1 736 1.05E-44 PLN03232 PLN03232 - N
multi-dom 130261 477 736 1.73E-44 TIGR01193 bacteriocin_ABC - N
multi-dom 224059 514 717 3.31E-38 COG1136 SalX - -
multi-dom 224054 514 726 1.67E-37 COG1131 CcmA - C
multi-dom 224047 507 729 1.39E-36 COG1122 CbiO - -
multi-dom 188098 488 726 2.41E-36 TIGR00957 MRP_assoc_pro - N
multi-dom 224051 517 719 3.61E-36 COG1126 GlnQ - -
multi-dom 131259 1 100 9.21E-36 TIGR02204 MsbA_rel - N
multi-dom 226361 498 719 2.26E-35 COG3842 PotA - C
multi-dom 240339 557 740 2.91E-35 PTZ00265 PTZ00265 - N
multi-dom 224041 500 695 4.89E-35 COG1116 TauB - C
multi-dom 237648 501 718 9.78E-35 PRK14250 PRK14250 - -
multi-dom 225183 2 101 1.20E-34 COG2274 SunT - N
multi-dom 224045 500 719 2.73E-34 COG1120 FepC - -
multi-dom 131258 1 100 3.97E-34 TIGR02203 MsbA_lipidA - N
multi-dom 183016 1 100 6.02E-34 PRK11176 PRK11176 - N
multi-dom 224052 500 723 2.35E-33 COG1127 Ttg2A - -
multi-dom 184214 1 100 4.85E-33 PRK13657 PRK13657 - N
multi-dom 224042 494 718 9.68E-33 COG1117 PstB - -
multi-dom 224050 516 726 1.66E-32 COG1125 OpuBA - C
multi-dom 188099 519 719 4.04E-32 TIGR00972 3a0107s01c2 - -
multi-dom 224055 2 102 4.51E-32 COG1132 MdlB - N
multi-dom 227590 1 96 1.49E-31 COG5265 ATM1 - N
multi-dom 188353 514 695 2.24E-31 TIGR03608 L_ocin_972_ABC - -
multi-dom 226359 499 719 6.92E-31 COG3839 MalK - C
multi-dom 233596 1 100 3.57E-30 TIGR01846 type_I_sec_HlyB - N
multi-dom 224048 505 719 1.08E-29 COG1123 COG1123 - C
multi-dom 224049 500 725 1.85E-29 COG1124 DppF - -
multi-dom 240327 483 719 1.96E-29 PTZ00243 PTZ00243 - N
multi-dom 237452 500 719 2.11E-29 PRK13632 cbiO - -
multi-dom 226643 522 719 4.10E-29 COG4175 ProV - C
multi-dom 172733 499 697 4.63E-29 PRK14245 PRK14245 - -
multi-dom 233209 1 97 9.25E-29 TIGR00958 3a01208 - N
multi-dom 236863 519 719 1.21E-28 PRK11153 metN - C
multi-dom 131368 502 723 2.12E-28 TIGR02315 ABC_phnC - -
multi-dom 234357 1 100 2.96E-28 TIGR03797 NHLM_micro_ABC2 - N
multi-dom 224048 519 725 3.91E-28 COG1123 COG1123 - N
multi-dom 226905 502 681 4.13E-28 COG4525 TauB - C
multi-dom 188394 502 726 5.12E-28 TIGR03864 PQQ_ABC_ATP - -
multi-dom 226164 502 719 1.21E-27 COG3638 COG3638 - -
multi-dom 224043 518 719 1.85E-27 COG1118 CysA - C
multi-dom 224046 499 714 2.10E-27 COG1121 ZnuC - -
multi-dom 163508 2 98 4.02E-27 TIGR03796 NHLM_micro_ABC1 - N
multi-dom 184586 497 695 4.56E-27 PRK14240 PRK14240 - -
multi-dom 184585 519 697 9.45E-27 PRK14239 PRK14239 - -
multi-dom 215650 542 667 1.95E-26 pfam00005 ABC_tran - -
multi-dom 130344 521 718 3.41E-26 TIGR01277 thiQ - -
multi-dom 130260 1 98 3.76E-26 TIGR01192 chvA - N
multi-dom 184582 519 695 5.26E-26 PRK14236 PRK14236 - -
multi-dom 130041 514 719 6.06E-26 TIGR00968 3a0106s01 - -
multi-dom 237457 519 718 8.29E-26 PRK13647 cbiO - C
multi-dom 237646 519 695 1.12E-25 PRK14237 PRK14237 - -
multi-dom 182692 519 695 1.14E-25 PRK10744 pstB - -
multi-dom 172741 518 697 1.29E-25 PRK14253 PRK14253 - -
multi-dom 226970 514 683 1.83E-25 COG4619 COG4619 - C
multi-dom 172757 522 697 1.86E-25 PRK14269 PRK14269 - -
multi-dom 226961 517 719 2.99E-25 COG4598 HisP - -
multi-dom 237649 522 697 3.14E-25 PRK14254 PRK14254 - N
multi-dom 131367 518 729 3.63E-25 TIGR02314 ABC_MetN - C
multi-dom 226360 521 725 3.87E-25 COG3840 ThiQ - -
multi-dom 184195 500 728 4.00E-25 PRK13635 cbiO - -
multi-dom 227321 1 103 4.41E-25 COG4988 CydD - N
multi-dom 226927 522 726 5.18E-25 COG4555 NatA - -
multi-dom 184202 500 725 5.32E-25 PRK13642 cbiO - -
multi-dom 236523 517 719 5.84E-25 PRK09452 potA - C
multi-dom 162242 533 719 6.00E-25 TIGR01187 potA - C
multi-dom 130234 509 694 6.20E-25 TIGR01166 cbiO - -
multi-dom 172750 514 718 6.67E-25 PRK14262 PRK14262 - -
multi-dom 225438 502 720 6.80E-25 COG2884 FtsE - -
multi-dom 172732 522 719 6.87E-25 PRK14244 PRK14244 - -
multi-dom 223521 514 719 1.30E-24 COG0444 DppD - C
multi-dom 183063 517 725 1.33E-24 PRK11264 PRK11264 - -
multi-dom 184208 503 719 1.52E-24 PRK13649 cbiO - -
multi-dom 184587 500 697 1.90E-24 PRK14241 PRK14241 - C
multi-dom 234152 517 719 2.45E-24 TIGR03265 PhnT2 - C
multi-dom 184594 519 697 3.01E-24 PRK14264 PRK14264 - -
multi-dom 237645 519 695 3.35E-24 PRK14235 PRK14235 - -
multi-dom 130254 522 719 5.26E-24 TIGR01186 proV - C
multi-dom 172747 525 697 8.67E-24 PRK14259 PRK14259 - C
multi-dom 226967 515 719 8.68E-24 COG4608 AppF - C
multi-dom 237651 514 697 9.20E-24 PRK14266 PRK14266 - -
multi-dom 172743 518 698 9.28E-24 PRK14255 PRK14255 - -
multi-dom 172739 514 718 1.02E-23 PRK14251 PRK14251 - -
multi-dom 181906 514 724 1.15E-23 PRK09493 glnQ - -
multi-dom 184205 522 727 1.40E-23 PRK13646 cbiO - -
multi-dom 132302 498 723 1.64E-23 TIGR03258 PhnT - C
multi-dom 226647 515 716 1.65E-23 COG4181 COG4181 - -
multi-dom 132027 500 695 1.80E-23 TIGR02982 heterocyst_DevA - -
multi-dom 172756 518 697 1.81E-23 PRK14268 PRK14268 - -
multi-dom 224053 519 715 4.61E-23 COG1129 MglA - C
multi-dom 237455 522 719 4.73E-23 PRK13637 cbiO - C
multi-dom 184207 505 719 6.06E-23 PRK13648 cbiO - -
multi-dom 183044 514 724 6.77E-23 PRK11231 fecE - -
multi-dom 236870 2 102 7.27E-23 PRK11174 PRK11174 - N
multi-dom 172730 504 697 9.69E-23 PRK14242 PRK14242 - -
multi-dom 240339 1 101 1.01E-22 PTZ00265 PTZ00265 - N
multi-dom 182221 519 740 1.04E-22 PRK10070 PRK10070 - C
multi-dom 131721 500 702 1.15E-22 TIGR02673 FtsE - -
multi-dom 131266 513 716 2.12E-22 TIGR02211 LolD_lipo_ex - -
multi-dom 184597 522 697 2.60E-22 PRK14270 PRK14270 - -
multi-dom 240327 522 725 2.80E-22 PTZ00243 PTZ00243 - NC
multi-dom 172748 519 697 2.84E-22 PRK14260 PRK14260 - -
multi-dom 184584 519 697 3.12E-22 PRK14238 PRK14238 - -
multi-dom 182528 500 695 3.89E-22 PRK10535 PRK10535 - C
multi-dom 131197 520 727 4.34E-22 TIGR02142 modC_ABC - C
multi-dom 184196 518 726 6.13E-22 PRK13636 cbiO - -
multi-dom 224060 517 670 6.59E-22 COG1137 YhbG - C
multi-dom 223488 519 719 8.03E-22 COG0411 LivG - -
multi-dom 233335 504 726 9.12E-22 TIGR01271 CFTR_protein - NC
multi-dom 223487 517 725 9.72E-22 COG0410 LivF - -
multi-dom 215640 500 727 1.30E-21 PLN03232 PLN03232 - NC
multi-dom 226641 519 718 1.49E-21 COG4172 COG4172 - N
multi-dom 215595 507 727 1.96E-21 PLN03130 PLN03130 - NC
multi-dom 237652 531 697 2.09E-21 PRK14275 PRK14275 - N
multi-dom 184209 500 727 2.16E-21 PRK13650 cbiO - -
multi-dom 182732 1 101 2.87E-21 PRK10789 PRK10789 - N
multi-dom 182716 521 697 3.84E-21 PRK10771 thiQ - -
multi-dom 130252 519 695 4.45E-21 TIGR01184 ntrCD - C
multi-dom 172760 519 723 4.71E-21 PRK14272 PRK14272 - -
multi-dom 130261 1 97 5.35E-21 TIGR01193 bacteriocin_ABC - N
multi-dom 182592 517 725 5.38E-21 PRK10619 PRK10619 - -
multi-dom 184593 495 700 5.72E-21 PRK14258 PRK14258 - -
multi-dom 184588 519 697 6.25E-21 PRK14243 PRK14243 - C
multi-dom 172735 514 718 7.36E-21 PRK14247 PRK14247 - -
multi-dom 184199 507 719 7.73E-21 PRK13639 cbiO - C
multi-dom 172751 506 697 9.31E-21 PRK14263 PRK14263 - C
multi-dom 184590 496 726 9.36E-21 PRK14249 PRK14249 - -
multi-dom 183226 522 718 9.66E-21 PRK11607 potG - C
multi-dom 188098 520 726 1.75E-20 TIGR00957 MRP_assoc_pro - NC
multi-dom 132050 517 718 1.83E-20 TIGR03005 ectoine_ehuA - -
multi-dom 237422 517 719 1.89E-20 PRK13548 hmuV - -
multi-dom 172749 519 698 2.03E-20 PRK14261 PRK14261 - -
multi-dom 172740 518 726 2.19E-20 PRK14252 PRK14252 - -
multi-dom 172745 501 701 3.12E-20 PRK14257 PRK14257 - N
multi-dom 237650 501 697 5.42E-20 PRK14265 PRK14265 - C
multi-dom 226963 500 724 5.76E-20 COG4604 CeuD - -
multi-dom 184200 500 719 6.96E-20 PRK13640 cbiO - C
multi-dom 226628 531 670 7.89E-20 COG4148 ModC - C
multi-dom 226635 522 722 8.54E-20 COG4161 ArtP - -
multi-dom 237419 500 721 8.91E-20 PRK13536 PRK13536 - C
multi-dom 237647 486 718 9.05E-20 PRK14248 PRK14248 - -
multi-dom 182733 1 110 9.25E-20 PRK10790 PRK10790 - N
multi-dom 237454 522 727 9.52E-20 PRK13634 cbiO - -
multi-dom 224051 1 88 9.97E-20 COG1126 GlnQ - N
multi-dom 163585 499 719 1.07E-19 TIGR03873 F420-0_ABC_ATP - -
multi-dom 131817 520 719 1.21E-19 TIGR02770 nickel_nikD - -
multi-dom 224057 514 719 1.49E-19 COG1134 TagH - -
multi-dom 172759 494 737 2.04E-19 PRK14271 PRK14271 - -
multi-dom 237456 522 722 2.13E-19 PRK13641 cbiO - C
multi-dom 223562 502 670 2.18E-19 COG0488 Uup - C
multi-dom 182778 522 695 2.48E-19 PRK10851 PRK10851 - C
multi-dom 226364 500 715 2.50E-19 COG3845 COG3845 - C
multi-dom 131816 517 728 2.64E-19 TIGR02769 nickel_nikE - -
multi-dom 172761 522 697 3.28E-19 PRK14273 PRK14273 - -
multi-dom 233335 486 710 4.03E-19 TIGR01271 CFTR_protein - N
multi-dom 237451 514 719 4.28E-19 PRK13631 cbiO - -
multi-dom 182331 514 709 5.70E-19 PRK10247 PRK10247 - -
multi-dom 130355 500 724 7.26E-19 TIGR01288 nodI - C
multi-dom 226646 516 696 8.27E-19 COG4178 COG4178 - N
multi-dom 234199 517 723 8.43E-19 TIGR03410 urea_trans_UrtE - -
multi-dom 172200 506 719 9.48E-19 PRK13652 cbiO - C
multi-dom 182980 502 722 9.90E-19 PRK11124 artP - -
multi-dom 172734 514 719 1.10E-18 PRK14246 PRK14246 - -
multi-dom 172762 518 697 1.35E-18 PRK14274 PRK14274 - -
multi-dom 236865 2 94 1.69E-18 PRK11160 PRK11160 - N
multi-dom 183056 522 684 1.77E-18 PRK11248 tauB - C
multi-dom 130256 519 719 1.82E-18 TIGR01188 drrA - C
multi-dom 224048 1 88 1.86E-18 COG1123 COG1123 - N
multi-dom 226967 1 88 2.04E-18 COG4608 AppF - NC
multi-dom 183133 522 727 2.50E-18 PRK11432 fbpC - C
multi-dom 234033 1 71 2.55E-18 TIGR02857 CydD - N
multi-dom 106587 500 725 3.89E-18 PRK13644 cbiO - -
multi-dom 224054 2 98 4.38E-18 COG1131 CcmA - N
multi-dom 224058 2 88 4.51E-18 COG1135 AbcC - NC
multi-dom 223562 504 726 4.79E-18 COG0488 Uup - N
multi-dom 226620 521 670 6.72E-18 COG4136 COG4136 - C
multi-dom 172744 519 697 1.02E-17 PRK14256 PRK14256 - -
multi-dom 234189 2 76 1.20E-17 TIGR03375 type_I_sec_LssB - N
multi-dom 188317 522 719 1.38E-17 TIGR03415 ABC_choXWV_ATP - C
multi-dom 226929 520 719 1.58E-17 COG4559 COG4559 - -
multi-dom 184203 523 719 1.62E-17 PRK13643 cbiO - C
multi-dom 236554 500 724 1.67E-17 PRK09536 btuD - C
multi-dom 236689 517 716 1.76E-17 PRK10419 nikE - -
multi-dom 237421 512 679 1.78E-17 PRK13539 PRK13539 - -
multi-dom 200134 1 87 2.20E-17 TIGR01842 type_I_sec_PrtD - N
multi-dom 224044 485 719 2.20E-17 COG1119 ModF - -
multi-dom 236898 520 726 2.36E-17 PRK11308 dppF - C
multi-dom 226969 1 88 2.70E-17 COG4618 ArpD - N
multi-dom 227320 1 93 2.76E-17 COG4987 CydC - N
multi-dom 224049 2 94 4.73E-17 COG1124 DppF - N
multi-dom 224059 1 78 5.13E-17 COG1136 SalX - N
multi-dom 215595 2 98 5.41E-17 PLN03130 PLN03130 - N
multi-dom 224026 516 697 5.52E-17 COG1101 PhnK - C
multi-dom 184596 517 695 8.74E-17 PRK14267 PRK14267 - -
multi-dom 237420 514 725 1.68E-16 PRK13537 PRK13537 - C
multi-dom 182182 523 719 1.90E-16 PRK09984 PRK09984 - -
multi-dom 182561 502 724 2.41E-16 PRK10575 PRK10575 - -
multi-dom 131377 517 681 4.31E-16 TIGR02324 CP_lyasePhnL - -
multi-dom 236947 500 670 4.73E-16 PRK11650 ugpC - C
multi-dom 182993 531 670 4.97E-16 PRK11144 modC - C
multi-dom 182829 518 700 6.19E-16 PRK10908 PRK10908 - -
multi-dom 183244 517 698 7.84E-16 PRK11629 lolD - -
multi-dom 182336 516 718 7.95E-16 PRK10253 PRK10253 - -
multi-dom 182569 517 673 9.76E-16 PRK10584 PRK10584 - C
multi-dom 223521 1 88 1.61E-15 COG0444 DppD - NC
multi-dom 188099 1 88 1.75E-15 TIGR00972 3a0107s01c2 - N
multi-dom 226641 514 725 1.98E-15 COG4172 COG4172 - C
multi-dom 184204 498 719 2.44E-15 PRK13645 cbiO - -
multi-dom 233207 516 719 2.45E-15 TIGR00955 3a01204 - C
multi-dom 162242 1 85 2.86E-15 TIGR01187 potA - NC
multi-dom 224048 2 88 3.46E-15 COG1123 COG1123 - NC
multi-dom 130254 1 118 3.68E-15 TIGR01186 proV - NC
multi-dom 223473 517 718 4.10E-15 COG0396 sufC - -
multi-dom 224047 2 90 5.63E-15 COG1122 CbiO - N
multi-dom 224050 1 88 5.71E-15 COG1125 OpuBA - NC
multi-dom 215640 2 98 6.18E-15 PLN03232 PLN03232 - N
multi-dom 185336 515 723 6.20E-15 PRK15439 PRK15439 - C
multi-dom 184198 514 729 7.46E-15 PRK13638 cbiO - -
multi-dom 237917 488 718 7.52E-15 PRK15134 PRK15134 - N
multi-dom 237453 522 719 9.68E-15 PRK13633 PRK13633 - -
multi-dom 236863 2 81 1.27E-14 PRK11153 metN - NC
multi-dom 130324 484 740 1.29E-14 TIGR01257 rim_protein - NC
multi-dom 226361 1 85 1.31E-14 COG3842 PotA - NC
multi-dom 188353 1 57 1.43E-14 TIGR03608 L_ocin_972_ABC - N
multi-dom 181906 1 88 1.43E-14 PRK09493 glnQ - N
multi-dom 182342 522 718 1.65E-14 PRK10261 PRK10261 - N
multi-dom 226961 1 88 1.84E-14 COG4598 HisP - N
multi-dom 132313 514 726 1.97E-14 TIGR03269 met_CoM_red_A2 - C
multi-dom 226637 519 725 2.03E-14 COG4167 SapF - -
multi-dom 188098 1 98 2.15E-14 TIGR00957 MRP_assoc_pro - N
multi-dom 182817 522 725 2.26E-14 PRK10895 PRK10895 - -
multi-dom 226617 511 674 2.67E-14 COG4133 CcmA - C
multi-dom 184210 510 697 2.80E-14 PRK13651 PRK13651 - C
multi-dom 182893 514 718 4.02E-14 PRK11000 PRK11000 - C
multi-dom 172750 1 88 6.60E-14 PRK14262 PRK14262 - N
multi-dom 226164 1 85 8.94E-14 COG3638 COG3638 - N
multi-dom 226622 521 724 1.05E-13 COG4138 BtuD - -
multi-dom 163452 517 670 1.12E-13 TIGR03740 galliderm_ABC - C
multi-dom 236523 1 81 1.26E-13 PRK09452 potA - NC
multi-dom 226641 2 88 1.29E-13 COG4172 COG4172 - N
multi-dom 182980 1 83 1.30E-13 PRK11124 artP - N
multi-dom 224042 1 88 1.37E-13 COG1117 PstB - N
multi-dom 226359 1 85 1.52E-13 COG3839 MalK - NC
multi-dom 236997 500 725 1.58E-13 PRK11831 PRK11831 - -
multi-dom 226635 1 83 1.60E-13 COG4161 ArtP - N
multi-dom 131367 1 88 1.93E-13 TIGR02314 ABC_MetN - NC
multi-dom 226631 514 719 2.42E-13 COG4152 COG4152 - C
multi-dom 184134 514 712 2.90E-13 PRK13549 PRK13549 - C
multi-dom 234152 1 85 3.25E-13 TIGR03265 PhnT2 - NC
multi-dom 235150 521 724 3.35E-13 PRK03695 PRK03695 - -
multi-dom 163483 523 723 3.64E-13 TIGR03771 anch_rpt_ABC - -
multi-dom 163431 517 673 4.25E-13 TIGR03719 ABC_ABC_ChvD - C
multi-dom 132561 520 725 5.12E-13 TIGR03522 GldA_ABC_ATP - C
multi-dom 224045 1 89 7.10E-13 COG1120 FepC - N
multi-dom 172757 1 88 7.63E-13 PRK14269 PRK14269 - N
multi-dom 183063 1 88 8.96E-13 PRK11264 PRK11264 - N
multi-dom 182592 1 88 1.04E-12 PRK10619 PRK10619 - N
multi-dom 240327 2 97 1.28E-12 PTZ00243 PTZ00243 - N
multi-dom 215634 517 721 1.62E-12 PLN03211 PLN03211 - C
multi-dom 183055 502 718 1.71E-12 PRK11247 ssuB - -
multi-dom 172732 1 88 1.92E-12 PRK14244 PRK14244 - N
multi-dom 226952 519 739 2.31E-12 COG4586 COG4586 - C
multi-dom 188208 500 718 2.37E-12 TIGR02323 CP_lyasePhnK - -
multi-dom 226641 1 93 2.38E-12 COG4172 COG4172 - NC
multi-dom 236688 514 737 2.43E-12 PRK10418 nikD - -
multi-dom 184195 1 85 2.65E-12 PRK13635 cbiO - N
multi-dom 185037 507 719 2.98E-12 PRK15079 PRK15079 - C
multi-dom 224043 1 84 3.18E-12 COG1118 CysA - NC
multi-dom 226643 1 88 3.18E-12 COG4175 ProV - NC
multi-dom 226646 2 58 3.82E-12 COG4178 COG4178 - N
multi-dom 184586 1 88 3.91E-12 PRK14240 PRK14240 - N
multi-dom 233305 511 673 4.23E-12 TIGR01189 ccmA - -
multi-dom 236755 502 712 4.84E-12 PRK10762 PRK10762 - C
multi-dom 184209 1 90 5.24E-12 PRK13650 cbiO - N
multi-dom 132313 520 725 5.45E-12 TIGR03269 met_CoM_red_A2 - N
multi-dom 234200 518 719 5.97E-12 TIGR03411 urea_trans_UrtD - -
multi-dom 184127 500 673 6.23E-12 PRK13540 PRK13540 - -
multi-dom 237451 1 95 6.52E-12 PRK13631 cbiO - N
multi-dom 131681 514 712 6.72E-12 TIGR02633 xylG - C
multi-dom 227118 517 682 6.81E-12 COG4778 PhnL - -
multi-dom 224046 1 110 6.94E-12 COG1121 ZnuC - N
multi-dom 184582 1 88 7.40E-12 PRK14236 PRK14236 - N
multi-dom 224052 2 90 7.60E-12 COG1127 Ttg2A - N
multi-dom 224041 1 57 9.73E-12 COG1116 TauB - NC
multi-dom 227019 518 719 1.01E-11 COG4674 COG4674 - -
multi-dom 185067 519 725 1.02E-11 PRK15112 PRK15112 - -
multi-dom 226927 2 85 1.05E-11 COG4555 NatA - N
multi-dom 131368 1 76 1.08E-11 TIGR02315 ABC_phnC - N
multi-dom 183077 522 723 1.08E-11 PRK11288 araG - C
multi-dom 182692 1 104 1.17E-11 PRK10744 pstB - N
multi-dom 132027 1 77 1.20E-11 TIGR02982 heterocyst_DevA - N
multi-dom 182221 1 93 1.27E-11 PRK10070 PRK10070 - NC
multi-dom 237917 520 725 1.37E-11 PRK15134 PRK15134 - C
multi-dom 185037 2 88 1.39E-11 PRK15079 PRK15079 - NC
multi-dom 224053 1 86 1.44E-11 COG1129 MglA - NC
multi-dom 172734 1 88 2.21E-11 PRK14246 PRK14246 - N
multi-dom 132050 1 88 2.31E-11 TIGR03005 ectoine_ehuA - N
multi-dom 188098 1 98 2.53E-11 TIGR00957 MRP_assoc_pro - NC
multi-dom 172762 1 90 2.55E-11 PRK14274 PRK14274 - N
multi-dom 172739 2 88 2.79E-11 PRK14251 PRK14251 - N
multi-dom 182036 519 718 2.92E-11 PRK09700 PRK09700 - C
multi-dom 182182 1 101 3.00E-11 PRK09984 PRK09984 - N
multi-dom 184585 1 88 3.07E-11 PRK14239 PRK14239 - N
multi-dom 183226 1 95 3.13E-11 PRK11607 potG - NC
multi-dom 184132 516 728 3.53E-11 PRK13547 hmuV - -
multi-dom 236898 2 88 4.42E-11 PRK11308 dppF - NC
multi-dom 131197 1 90 4.87E-11 TIGR02142 modC_ABC - NC
multi-dom 226592 500 718 7.81E-11 COG4107 PhnK - -
multi-dom 183231 522 669 9.05E-11 PRK11614 livF - C
multi-dom 172740 1 85 9.07E-11 PRK14252 PRK14252 - N
multi-dom 237452 1 92 9.17E-11 PRK13632 cbiO - N
multi-dom 233665 514 718 1.09E-10 TIGR01978 sufC - -
multi-dom 215650 1 29 1.35E-10 pfam00005 ABC_tran - N
multi-dom 234041 2 59 1.51E-10 TIGR02868 CydC - N
multi-dom 236992 517 673 1.79E-10 PRK11819 PRK11819 - C
multi-dom 184207 1 92 1.92E-10 PRK13648 cbiO - N
multi-dom 131721 1 64 2.11E-10 TIGR02673 FtsE - N
multi-dom 225438 1 72 2.63E-10 COG2884 FtsE - N
multi-dom 223487 1 90 2.96E-10 COG0410 LivF - N
multi-dom 226360 1 87 3.21E-10 COG3840 ThiQ - N
multi-dom 172751 1 88 3.26E-10 PRK14263 PRK14263 - N
multi-dom 172741 1 88 3.34E-10 PRK14253 PRK14253 - N
multi-dom 183280 518 718 3.50E-10 PRK11701 phnK - -
multi-dom 184202 1 90 3.68E-10 PRK13642 cbiO - N
multi-dom 130041 1 85 4.24E-10 TIGR00968 3a0106s01 - N
multi-dom 172760 1 88 4.35E-10 PRK14272 PRK14272 - N
multi-dom 225265 523 696 4.37E-10 COG2401 COG2401 - N
multi-dom 237646 1 88 4.57E-10 PRK14237 PRK14237 - N
multi-dom 237648 1 88 4.96E-10 PRK14250 PRK14250 - N
multi-dom 184596 1 88 5.17E-10 PRK14267 PRK14267 - N
multi-dom 237651 1 88 5.91E-10 PRK14266 PRK14266 - N
multi-dom 226970 1 43 6.21E-10 COG4619 COG4619 - NC
multi-dom 172761 1 88 6.48E-10 PRK14273 PRK14273 - N
multi-dom 131817 1 88 6.79E-10 TIGR02770 nickel_nikD - N
multi-dom 215558 464 681 7.38E-10 PLN03073 PLN03073 - N
multi-dom 181939 517 697 7.45E-10 PRK09544 znuC - C
multi-dom 184597 1 88 7.50E-10 PRK14270 PRK14270 - N
multi-dom 132313 1 87 7.70E-10 TIGR03269 met_CoM_red_A2 - NC
multi-dom 130344 1 80 7.87E-10 TIGR01277 thiQ - N
multi-dom 223488 1 90 8.60E-10 COG0411 LivG - N
multi-dom 185016 522 740 9.16E-10 PRK15056 PRK15056 - -
multi-dom 226968 164 664 9.74E-10 COG4615 PvdE - -
multi-dom 182778 1 85 9.79E-10 PRK10851 PRK10851 - NC
multi-dom 172730 1 104 9.80E-10 PRK14242 PRK14242 - N
multi-dom 237649 1 88 1.10E-09 PRK14254 PRK14254 - N
multi-dom 132302 1 85 1.27E-09 TIGR03258 PhnT - NC
multi-dom 184584 1 88 1.48E-09 PRK14238 PRK14238 - N
multi-dom 130256 1 85 1.75E-09 TIGR01188 drrA - NC
multi-dom 226364 1 75 2.06E-09 COG3845 COG3845 - NC
multi-dom 236707 504 664 2.40E-09 PRK10522 PRK10522 - N
multi-dom 226647 1 78 2.64E-09 COG4181 COG4181 - N
multi-dom 237453 1 88 2.75E-09 PRK13633 PRK13633 - N
multi-dom 172733 1 88 2.89E-09 PRK14245 PRK14245 - N
multi-dom 237645 1 90 3.06E-09 PRK14235 PRK14235 - N
multi-dom 131377 2 54 3.19E-09 TIGR02324 CP_lyasePhnL - N
multi-dom 182342 2 94 3.35E-09 PRK10261 PRK10261 - N
multi-dom 131266 1 78 4.12E-09 TIGR02211 LolD_lipo_ex - N
multi-dom 182993 1 81 4.58E-09 PRK11144 modC - NC
multi-dom 237455 1 90 4.61E-09 PRK13637 cbiO - N
multi-dom 131816 1 78 4.86E-09 TIGR02769 nickel_nikE - N
multi-dom 234199 2 96 5.05E-09 TIGR03410 urea_trans_UrtE - N
multi-dom 233207 1 87 6.44E-09 TIGR00955 3a01204 - NC
multi-dom 132313 1 87 6.55E-09 TIGR03269 met_CoM_red_A2 - N
multi-dom 172744 1 90 6.61E-09 PRK14256 PRK14256 - N
multi-dom 182528 1 76 6.84E-09 PRK10535 PRK10535 - NC
multi-dom 237650 1 80 7.42E-09 PRK14265 PRK14265 - N
multi-dom 172749 1 88 7.49E-09 PRK14261 PRK14261 - N
multi-dom 184205 1 87 7.96E-09 PRK13646 cbiO - N
multi-dom 237917 2 81 9.19E-09 PRK15134 PRK15134 - N
multi-dom 240327 1 119 9.61E-09 PTZ00243 PTZ00243 - NC
multi-dom 226364 510 715 9.74E-09 COG3845 COG3845 - N
multi-dom 183133 1 85 1.01E-08 PRK11432 fbpC - NC
multi-dom 184125 511 673 1.05E-08 PRK13538 PRK13538 - C
multi-dom 215599 517 698 1.09E-08 PLN03140 PLN03140 - NC
multi-dom 182906 522 719 1.13E-08 PRK11022 dppD - C
multi-dom 188394 1 85 1.17E-08 TIGR03864 PQQ_ABC_ATP - N
multi-dom 226628 1 90 1.19E-08 COG4148 ModC - NC
multi-dom 237917 1 87 1.22E-08 PRK15134 PRK15134 - NC
multi-dom 237647 1 88 1.25E-08 PRK14248 PRK14248 - N
multi-dom 172759 1 88 1.26E-08 PRK14271 PRK14271 - N
multi-dom 106587 1 88 1.31E-08 PRK13644 cbiO - N
multi-dom 172748 1 88 1.34E-08 PRK14260 PRK14260 - N
multi-dom 184588 1 59 1.54E-08 PRK14243 PRK14243 - NC
multi-dom 182342 519 670 1.67E-08 PRK10261 PRK10261 - C
multi-dom 184587 1 88 1.90E-08 PRK14241 PRK14241 - N
multi-dom 184199 1 98 2.03E-08 PRK13639 cbiO - N
multi-dom 182331 1 41 2.03E-08 PRK10247 PRK10247 - NC
multi-dom 227019 1 98 2.19E-08 COG4674 COG4674 - N
multi-dom 224166 520 700 2.20E-08 COG1245 COG1245 - N
multi-dom 184200 1 89 2.22E-08 PRK13640 cbiO - N
multi-dom 172200 1 90 2.26E-08 PRK13652 cbiO - N
multi-dom 184590 1 116 2.33E-08 PRK14249 PRK14249 - N
multi-dom 130262 482 716 2.40E-08 TIGR01194 cyc_pep_trnsptr - N
multi-dom 226929 1 89 2.52E-08 COG4559 COG4559 - N
multi-dom 172743 1 88 2.83E-08 PRK14255 PRK14255 - N
multi-dom 226637 1 88 3.03E-08 COG4167 SapF - N
multi-dom 237454 1 102 3.14E-08 PRK13634 cbiO - N
multi-dom 184594 1 88 3.64E-08 PRK14264 PRK14264 - N
multi-dom 183080 520 719 3.71E-08 PRK11300 livG - -
multi-dom 236689 1 78 3.98E-08 PRK10419 nikE - N
multi-dom 224044 1 69 4.35E-08 COG1119 ModF - N
multi-dom 172735 1 88 5.64E-08 PRK14247 PRK14247 - N
multi-dom 172756 1 88 6.33E-08 PRK14268 PRK14268 - N
multi-dom 172747 1 59 6.39E-08 PRK14259 PRK14259 - NC
multi-dom 236729 464 695 6.50E-08 PRK10636 PRK10636 - NC
multi-dom 130234 1 56 6.74E-08 TIGR01166 cbiO - N
multi-dom 237652 1 118 6.77E-08 PRK14275 PRK14275 - N
multi-dom 224166 493 700 6.89E-08 COG1245 COG1245 - C
multi-dom 233208 514 673 7.26E-08 TIGR00956 3a01205 - NC
multi-dom 184129 511 670 8.64E-08 PRK13543 PRK13543 - C
multi-dom 224026 1 76 9.30E-08 COG1101 PhnK - N
multi-dom 172745 1 80 9.39E-08 PRK14257 PRK14257 - N
multi-dom 181965 517 721 9.78E-08 PRK09580 sufC - -
multi-dom 182893 1 85 1.11E-07 PRK11000 PRK11000 - NC
multi-dom 226963 1 89 1.23E-07 COG4604 CeuD - N
multi-dom 163585 1 60 1.28E-07 TIGR03873 F420-0_ABC_ATP - NC
multi-dom 214640 527 688 1.50E-07 smart00382 AAA - C
multi-dom 237456 1 90 1.58E-07 PRK13641 cbiO - N
multi-dom 183055 1 32 1.85E-07 PRK11247 ssuB - NC
multi-dom 130252 1 43 1.98E-07 TIGR01184 ntrCD - NC
multi-dom 214372 514 719 2.53E-07 CHL00131 ycf16 - -
multi-dom 223562 1 57 2.55E-07 COG0488 Uup - NC
multi-dom 130324 523 726 2.86E-07 TIGR01257 rim_protein - N
multi-dom 233208 517 700 2.96E-07 TIGR00956 3a01205 - C
multi-dom 237420 1 91 3.31E-07 PRK13537 PRK13537 - NC
multi-dom 184204 1 90 3.40E-07 PRK13645 cbiO - N
multi-dom 224053 518 670 3.78E-07 COG1129 MglA - N
multi-dom 223562 1 57 3.89E-07 COG0488 Uup - N
multi-dom 227118 2 54 4.00E-07 COG4778 PhnL - N
multi-dom 237422 2 89 4.69E-07 PRK13548 hmuV - N
multi-dom 183056 1 43 4.99E-07 PRK11248 tauB - NC
multi-dom 183044 1 89 5.30E-07 PRK11231 fecE - N
multi-dom 233206 514 698 5.54E-07 TIGR00954 3a01203 - N
multi-dom 184210 1 90 6.42E-07 PRK13651 PRK13651 - N
multi-dom 182716 1 32 6.45E-07 PRK10771 thiQ - NC
multi-dom 130355 1 91 6.53E-07 TIGR01288 nodI - NC
multi-dom 236554 1 89 6.56E-07 PRK09536 btuD - NC
multi-dom 163483 1 85 6.59E-07 TIGR03771 anch_rpt_ABC - N
multi-dom 226592 2 97 6.77E-07 COG4107 PhnK - N
multi-dom 183280 2 80 6.96E-07 PRK11701 phnK - N
multi-dom 184134 3 75 7.11E-07 PRK13549 PRK13549 - NC
multi-dom 163452 2 84 7.35E-07 TIGR03740 galliderm_ABC - N
multi-dom 188208 2 97 7.58E-07 TIGR02323 CP_lyasePhnK - N
multi-dom 188317 1 88 8.12E-07 TIGR03415 ABC_choXWV_ATP - NC
multi-dom 237419 1 57 8.12E-07 PRK13536 PRK13536 - NC
multi-dom 226905 1 57 9.73E-07 COG4525 TauB - NC
multi-dom 215634 1 61 1.03E-06 PLN03211 PLN03211 - NC
multi-dom 234200 1 92 1.07E-06 TIGR03411 urea_trans_UrtD - N
multi-dom 184593 1 88 1.18E-06 PRK14258 PRK14258 - N
multi-dom 233335 1 109 1.32E-06 TIGR01271 CFTR_protein - NC
multi-dom 185016 1 76 1.42E-06 PRK15056 PRK15056 - N
multi-dom 182906 1 85 1.46E-06 PRK11022 dppD - NC
multi-dom 237457 1 90 1.55E-06 PRK13647 cbiO - N
multi-dom 181888 505 670 1.62E-06 PRK09473 oppD - C
multi-dom 233206 1 63 1.79E-06 TIGR00954 3a01203 - N
multi-dom 223473 1 58 1.91E-06 COG0396 sufC - N
multi-dom 163431 1 41 2.00E-06 TIGR03719 ABC_ABC_ChvD - NC
multi-dom 163431 494 699 2.69E-06 TIGR03719 ABC_ABC_ChvD - N
multi-dom 184203 1 115 2.93E-06 PRK13643 cbiO - N
multi-dom 224057 2 86 3.30E-06 COG1134 TagH - N
multi-dom 182342 1 85 3.68E-06 PRK10261 PRK10261 - NC
multi-dom 214640 2 69 3.75E-06 smart00382 AAA - N
multi-dom 185067 4 87 4.15E-06 PRK15112 PRK15112 - N
multi-dom 182852 522 725 4.16E-06 PRK10938 PRK10938 - C
multi-dom 236992 2 35 4.31E-06 PRK11819 PRK11819 - NC
multi-dom 235150 1 89 5.10E-06 PRK03695 PRK03695 - N
multi-dom 183244 1 78 5.17E-06 PRK11629 lolD - N
multi-dom 185336 518 670 5.20E-06 PRK15439 PRK15439 - N
multi-dom 233335 1 87 5.92E-06 TIGR01271 CFTR_protein - N
multi-dom 236861 523 715 8.11E-06 PRK11147 PRK11147 - C
multi-dom 184037 638 697 8.60E-06 PRK13409 PRK13409 - NC
multi-dom 182829 1 62 9.09E-06 PRK10908 PRK10908 - N
multi-dom 224166 1 62 9.61E-06 COG1245 COG1245 - NC
multi-dom 236947 2 85 1.09E-05 PRK11650 ugpC - NC
multi-dom 131681 3 97 1.13E-05 TIGR02633 xylG - NC
multi-dom 185336 6 87 1.23E-05 PRK15439 PRK15439 - NC
multi-dom 226364 2 76 1.28E-05 COG3845 COG3845 - N
multi-dom 184208 1 76 1.30E-05 PRK13649 cbiO - NC
multi-dom 224053 1 93 1.35E-05 COG1129 MglA - N
multi-dom 184196 1 106 1.59E-05 PRK13636 cbiO - N
multi-dom 184198 1 87 1.77E-05 PRK13638 cbiO - N
multi-dom 226620 1 57 2.01E-05 COG4136 COG4136 - N
multi-dom 226639 638 728 2.07E-05 COG4170 SapD - NC
multi-dom 184037 639 700 2.79E-05 PRK13409 PRK13409 - N
multi-dom 226968 1 79 3.61E-05 COG4615 PvdE - N
multi-dom 182561 1 89 3.95E-05 PRK10575 PRK10575 - N
multi-dom 225265 1 58 5.20E-05 COG2401 COG2401 - N
multi-dom 181888 2 32 5.95E-05 PRK09473 oppD - NC
multi-dom 236688 1 88 6.02E-05 PRK10418 nikD - N
multi-dom 224060 1 90 6.40E-05 COG1137 YhbG - N
multi-dom 183077 1 87 8.42E-05 PRK11288 araG - NC
multi-dom 182852 514 705 9.56E-05 PRK10938 PRK10938 - N
multi-dom 224166 1 62 9.85E-05 COG1245 COG1245 - N
multi-dom 181939 1 32 0.00010111 PRK09544 znuC - NC
multi-dom 132561 1 57 0.000103811 TIGR03522 GldA_ABC_ATP - NC
multi-dom 214372 2 81 0.000110134 CHL00131 ycf16 - N
multi-dom 184037 2 59 0.00012455 PRK13409 PRK13409 - NC
multi-dom 237421 2 70 0.000133724 PRK13539 PRK13539 - N
multi-dom 182336 1 89 0.000135385 PRK10253 PRK10253 - N
multi-dom 226617 1 67 0.000141585 COG4133 CcmA - N
multi-dom 182569 1 57 0.000153033 PRK10584 PRK10584 - N
multi-dom 236707 1 83 0.000170645 PRK10522 PRK10522 - N
multi-dom 215558 2 57 0.000212927 PLN03073 PLN03073 - NC
multi-dom 130324 1 106 0.000223713 TIGR01257 rim_protein - NC
multi-dom 215558 1 40 0.000231136 PLN03073 PLN03073 - N
multi-dom 182817 1 89 0.000260224 PRK10895 PRK10895 - N
multi-dom 236861 1 35 0.000311219 PRK11147 PRK11147 - NC
multi-dom 226952 1 85 0.000313563 COG4586 COG4586 - NC
multi-dom 223256 2 92 0.000356244 COG0178 UvrA - NC
multi-dom 226622 1 89 0.000360052 COG4138 BtuD - N
multi-dom 131681 1 77 0.000460579 TIGR02633 xylG - N
multi-dom 185049 522 728 0.000483245 PRK15093 PRK15093 - C
multi-dom 130324 2 104 0.000489762 TIGR01257 rim_protein - N
multi-dom 236997 1 90 0.000523 PRK11831 PRK11831 - N
multi-dom 233665 2 80 0.000610082 TIGR01978 sufC - N
multi-dom 236755 1 32 0.000625822 PRK10762 PRK10762 - N
multi-dom 233305 1 56 0.000664023 TIGR01189 ccmA - N
multi-dom 236755 1 75 0.000674139 PRK10762 PRK10762 - NC
multi-dom 183231 1 89 0.00073756 PRK11614 livF - N
multi-dom 236755 639 670 0.000742364 PRK10762 PRK10762 - N
multi-dom 184037 2 62 0.000805246 PRK13409 PRK13409 - N
multi-dom 131681 452 670 0.000968916 TIGR02633 xylG - N
multi-dom 163431 1 61 0.00118674 TIGR03719 ABC_ABC_ChvD - N
multi-dom 237894 2 84 0.00121386 PRK15064 PRK15064 - N
multi-dom 233062 1 86 0.001256 TIGR00630 uvra - N
multi-dom 182880 1 56 0.00157417 PRK10982 PRK10982 - N
multi-dom 236861 1 44 0.00201102 PRK11147 PRK11147 - NC
multi-dom 215558 638 670 0.00247422 PLN03073 PLN03073 - NC
multi-dom 182880 639 670 0.00254211 PRK10982 PRK10982 - N
multi-dom 236729 2 43 0.00258687 PRK10636 PRK10636 - NC
multi-dom 226639 4 87 0.00264244 COG4170 SapD - NC
multi-dom 223256 616 736 0.00276608 COG0178 UvrA - N
multi-dom 184128 1 68 0.00298882 PRK13541 PRK13541 - N
multi-dom 184128 521 677 0.00304192 PRK13541 PRK13541 - -
multi-dom 184131 2 86 0.00307514 PRK13546 PRK13546 - N
multi-dom 184134 1 77 0.0030923 PRK13549 PRK13549 - N
multi-dom 226631 1 62 0.0032894 COG4152 COG4152 - NC
multi-dom 215599 1 80 0.00354339 PLN03140 PLN03140 - NC
multi-dom 223496 1 57 0.0036063 COG0419 SbcC - N
multi-dom 184134 638 670 0.00367767 PRK13549 PRK13549 - N
multi-dom 182036 1 89 0.00428398 PRK09700 PRK09700 - N
multi-dom 223256 2 68 0.00446825 COG0178 UvrA - N
multi-dom 182852 1 67 0.00550797 PRK10938 PRK10938 - N
multi-dom 182036 1 87 0.00551756 PRK09700 PRK09700 - NC
multi-dom 233208 2 56 0.005549 TIGR00956 3a01205 - C
multi-dom 237894 639 682 0.00621325 PRK15064 PRK15064 - N
multi-dom 184130 2 90 0.00625782 PRK13545 tagH - NC
multi-dom 130262 1 57 0.00672812 TIGR01194 cyc_pep_trnsptr - N
multi-dom 234631 528 549 0.00679185 PRK00098 PRK00098 - NC
multi-dom 185336 1 76 0.00826491 PRK15439 PRK15439 - N
multi-dom 184125 2 44 0.00901716 PRK13538 PRK13538 - N
multi-dom 185049 1 98 0.00997392 PRK15093 PRK15093 - NC
Conserved sites/feature
Type Brief name Coordinates Complete size Mapped size Source domain
specific ATP binding site G538,S539,K541,S542,T543,Q583,D663,E664,H695 9 9 213216
specific ABC transporter signature motif L639,S640,G641,G642,Q643,K644,Q645,R646,V647,A648 10 10 213216
specific Walker A/P-loop G535,Q536,S537,G538,S539,G540,K541,S542 8 8 213216
specific Walker B I659,M660,L661,L662,D663,E664 6 6 213216
specific D-loop S667,A668,L669,D670 4 4 213216
specific Q-loop/lid L580,V581,S582,Q583 4 4 213216
specific H-loop/switch region V691,V692,V693,A694,H695,R696,L697 7 7 213216
generic ATP binding site D25,E26,H57 9 3 213216
generic ABC transporter signature motif M1,S2,G3,G4,Q5,K6,Q7,R8,I9,A10 10 10 213216
generic Walker A/P-loop 8 0 213216
generic Walker B I21,L22,L23,L24,D25,E26 6 6 213216
generic D-loop S29,A30,L31,D32 4 4 213216
generic Q-loop/lid 4 0 213216
generic H-loop/switch region I53,V54,V55,A56,H57,R58,L59 7 7 213216
 
DNA sequence
Upstream 1000 bp region from PH01000169G0700 gene.
AGCTAAGGCGGGTCAACTTTACTTGATAGGATGGATGATCATTGATCACTCAAACAGTCCAGCAAAGCATTGATCTTTCTACTGAAAACATAATTAAACAAAAGATTAGTTTGGAATGATGAAAAGTACATCTATAACAGGATGATGCTAGTGTGGTGTTCTGTAACCCAATATTCATGGCAGCGATTTGTATGTATGGCTAAAAAATTGTTGATGTATCATTAAAATGATGACAAACAACCTAGCGATCAACCCTATCCTATCTGAAGATGGGCCACCTTATCCTCCATGAATGAACATCTTCATTGGCAATTGCCAGTTCCCATCAGTCATGACACCATTAATGGGGGAGGGCCGGAGGGGTCAAGTTAGGACAAGATAAAGTTCACTGGCCAGTTCAGGCAACGAAATAATGAGCTAATTGCTAAATGCTGACTTATACAACAATGGTCCGAGTGCTCTGCTGAACATAAACAGAATTGCTTCCCCATGCCGGTTGCCTATGTTGTCGGTTTCTTCCTCGATGCCATATCATGCTAAGGCGTTTCTTTCTTGGGCGTCATATGTCGAAGTGTCGCTAATCTGCTCTCAAGCGAACCGACGCTGGTATCGGATACTTTTATCAACATGGGGTTGCAAAGGACTTCAACTGTGGCCACCACCGCAGCTCGAGGACGAGCTGCCTCGCCGTGAGCGGTGTAATGTTATGGAGAAAGACGTGAGGGGCTGTAGCGCGTGCATGAACAATACCACATGTACTGTAGCACGTGTGAGCAGTACCCACCGATACTGTAGCGCCTTTATTTCCATATTGGTTGATTGGTTTCCTAGAATAAAGAATAGTTGGTTAGGTATGTTATTTTGGGATTCCTTATCTATCTAGTTATTGTTAGGAATATAATCTTATTTATTAGGAAGGTTATTATTAATAGTTGGAAAGGTTAGATTGGATTGATATGTTTCCTTATAGATTATTTCTTAGGCGTCAAGTTGGACTGTCC
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGTCCGGAGGGCAGAAGCAGAGGATTGCAATTGCAAGAGCAATCCTGAAGTCACCCAAGATCCTCCTCCTTGACGAGGCGACCAGTGCACTGGACACCGAGTCAGAGCGTGTTGTGCAGGAGGCACTTGACATGGCTGCCATGGGCCGGACTACTATTGTCGTTGCTCATCGCCTCTCTACCATCCGTAATGCTGAAATCATTGCTGTCATGCGGTCTGGCGAGATCAAGGAGCTTGGTTCCCATGACGAGCTCATTTCCAATGAGGATGGCATCTACTCATCTCTTGTCCGGTTTCAGCAGACCAGGGATTCACATGAGGCTGATGTGATTGCTAACACTGGCAGAATGTCTGCAGTGGGCCAATCTTGCAGCCACAGCATGAGCAGGAGGTTGTCTGCAGCCAGCAGGTCAAGCTCAGCCCAATCTTTTGGCAATGCAGGGGATGCTGATGACACCGAGAAGCACAAACTGTCTGTGCCATCCTTTATGAGGCTGCTCATGCTCAATGCACCAGAATGGAGGCAAGCATTGCTCGGGAGCTTCAGTGCAATCATGTTTGGGGGTATCCAACCTGTGTATGCCTATGCCATGGGAAGTATGCTGTCCGTCTACTTCTTGACAGATCACACAGAGATCAAGGAGAAGAAAAGGACATACACGCTCGTCTTCATTGCCCTTACAGTGCTTTCATTCGTGATCAATATTGGGCAGCATTACAACTTGGGTGCCATGGGAGAATACCTCACTAAGAGGGTCCGGGAACAGATGCTTGCAAAGATCCTCACATTTGAGATTGGGTGGTTTGATCGTGATGAGAACTCAAGTGGTGCCATTTGCTCACAGCTTGCCAAGGATGCCAATGTCGTGAGGTCTCTTGTAGGTGAACGGATGGCTCTGGTGATCCAAACGATATCTTCAGTCCTCATCGCTTTCACCATGGGTTTGATCATTGCTTGGCGGTTGGCCCTTGTCATGATTGCCATGCAGCCACTAATCATCATCTGCTACTATGTCCGCCGTGTATTGCTCAAGAGCATGTCCAAGAAATCAATGCAAGCACAAGCTGCAAGCAGTAAGCTGGCCGCTGAGGCTGTCTCCAATCTTCGTACCATTACGGCTTTCTCATCCCAGGACCACATCCTCCGCCTCTTCAACCAAGCACAAGACAAGCCATGCAAAGAGAGCATCCGACAATCATGGTTTGCAGGCCTTGGTCTCGGAACCTCCATGTGCCTCATGACGTGCACATGGGCCCTAAACTTCTGGTATGGTGGGCAGCTCATGGCTGAACATCACATTACTGCCGAGGCACTCTTCCGAACTTTCATGATTCTAGTAAGCACAGGGCGTGTCATTGCTGACGCAGGAAGCATGACAACAGACCTGGCTAAGGGTGCTGATGCAGTCACTTCAGTGTTCGCCATTCTCGACAGGGTAACACTTATCGACCCTGACAACCCTGAGGGCTACAAGCCAGAGAAGCTAGAAGGTGAGGTAGACATCAGCGGAGTTGACTTTGCATATCCATCAAGGCTGGACGTGATCATCTTCAAAGGATTCTCATTGAGCATACAACCAGGCAAGTCGACAGCGCTGGTCGGGCAAAGTGGTTCCGGGAAATCGACCATCATAGGGCTGATAGAGCGGTTCTACGACCCACTTAAGGGGTCAGTGAAGATTGATGGCAGGGATATCAAGGCATACAATCTCAGATCCCTCCGAATGCACATTGGGCTGGTCAGCCAAGAGCCAGCACTGTTTGCAGGCACCATCCGAGAGAACATCATGTATGGCTTACATACTGCAACGGAGGTAGAAATTGAGAATGCAGCAAGGTCTGCCAATGCACATGACTTCATCAGCAACCTCAAGGATGGTTATGACACATGGTGCGGTGAGCGGGGTGTTCAGCTTTCAGGAGGACAGAAGCAGCGTGTCGCGATCGCCCGCGCCATTCTGAAGAATCCTGCCATAATGCTGCTGGACGAGTCAACAAGCGCGCTGGACAGTCAGTCCGAGAACGCAGTGCAAGAGGCGCTTGACCGGGTGATGGTTGGGAGGACGAGCGTCGTGGTAGCGCACAGGCTCAGCACCATCCAGAACTGCGAAACGATCGCTGTGCTGGAGAAAGGCGTCGTTGTGGAGAAGGGCACGCACGCCTCCCTTATGGCCAAGGGTCACACCGGGACATACTTTGCCTTGGTCAGCTTGCAGAAGGGTGGCAACCAGCACTGA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01000169G0700 gene.
ATAAAGTGCTGACCTGTGTTCTTGGAGCTTAACCATCCCTCTGAACGACAAATCATTTCAACACAGTACTAATTTACCAGTCAATACTCAACAGCTTCCTCCTGATTCTTAGAATTTGCATAGGGTACAAGTGGTTCTGGTCCTGAAACAAGAAAGGAGAAGGCGGAAATCACCTAAGAGGAGAAGACGTCGGGTTGGGGTTGCGCTGGCGATTTCGGCGGTGGCGCCGAAGAGGATCGGCGAGGGAGGGGCGAGGGAGGCGGCGGGGGTGGGGGAGGGTGCGCGCGGGCTGTCGGGGTTGGGTCTTGTGGTGGACTTGCAGTACCCGACGGACGGGCATCTTTGTGGAGGAGAAAGTATGCCTCCGCACCAGGGCGCGCCGGCGACGTCTGACACCGCCTCCTGCAAGCGCCGCCCGGTGAGGAATCTTGGCGACGAGGCCAAATGCTGCGACGAGACCGAGAGGGAGAGGCCCATCACAAAAGGTCGAAGAGGGGAGGGCGGCCGTCCGTGCGCAAACGTGAACCAACTTCGGCCTAGTTGGAGAATTTTCCTTTCCCGCCGTGCGGGCGTGCGGCCCATGCCCATCTACCCATCTATCTCCCCCCGCGGCATACGCGCATTGCGCTTGCGCATAGCCACCTCCACCGGTAAGCGGCCAACCTCCCAACCGCGCGCCGCCGACCTGGACAGGCCCATCCGTCTGAGCGCGCGGCCCGCGGCGCAGTAAAATTTCGCCTTTTCACGTGGTCCACCTCCGGGGCACGGCTCGCTTCTCTCCGACCTCAGGAATTGGTGAGAGCAGGGCCCATATCTAATGATTCGGTCCAGAGACGCCGCGCGCGCCGGGCGCCCTGCACTACCGAAACGTCCGAACGGGCCATGCCTGAAGGTTCTCCTCCGAAGAATCTTGCCACAAGGCCCGTCCTCAACAGCCCAACATGCGTGGCTTCTGACGTGAAGTTCCAATCAAATGCTGTCAGCTATACAATGTGAATTGA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01000169 Download
Protein sequence
Protein sequence
MSGGQKQRIAIARAILKSPKILLLDEATSALDTESERVVQEALDMAAMGRTTIVVAHRLSTIRNAEIIAVMRSGEIKELGSHDELISNEDGIYSSLVRFQQTRDSHEADVIANTGRMSAVGQSCSHSMSRRLSAASRSSSAQSFGNAGDADDTEKHKLSVPSFMRLLMLNAPEWRQALLGSFSAIMFGGIQPVYAYAMGSMLSVYFLTDHTEIKEKKRTYTLVFIALTVLSFVINIGQHYNLGAMGEYLTKRVREQMLAKILTFEIGWFDRDENSSGAICSQLAKDANVVRSLVGERMALVIQTISSVLIAFTMGLIIAWRLALVMIAMQPLIIICYYVRRVLLKSMSKKSMQAQAASSKLAAEAVSNLRTITAFSSQDHILRLFNQAQDKPCKESIRQSWFAGLGLGTSMCLMTCTWALNFWYGGQLMAEHHITAEALFRTFMILVSTGRVIADAGSMTTDLAKGADAVTSVFAILDRVTLIDPDNPEGYKPEKLEGEVDISGVDFAYPSRLDVIIFKGFSLSIQPGKSTALVGQSGSGKSTIIGLIERFYDPLKGSVKIDGRDIKAYNLRSLRMHIGLVSQEPALFAGTIRENIMYGLHTATEVEIENAARSANAHDFISNLKDGYDTWCGERGVQLSGGQKQRVAIARAILKNPAIMLLDESTSALDSQSENAVQEALDRVMVGRTSVVVAHRLSTIQNCETIAVLEKGVVVEKGTHASLMAKGHTGTYFALVSLQKGGNQH
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above