gene PH01000123G1430
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01000123:1001278 - 1015181(+ stand)   Name
Alternate name Locus tag PH01000123G1430
Length of gene 13904  bp Length of CDS 3876  bp
Product information
Feature type
CDS
Product name
HEAT repeat family protein
Alternate name
Molecular weight
(predicted)
142696.625019999  kDa
Isoeletric point
(predicted)
5.69938278198242
Length
1291  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
(0 result)
SNP ID Position Base in Scaffold Polymorphism
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_128781 1
Please click OG5_128781 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
Gene ID Short description Curator summary Computational description E-value
AT2G02560.2
cullin-associated and neddylation dissociated
Arabidopsis thaliana homolog of human CAND1 (cullin-associated and neddylation-dissociated). Putative similarity to TBP-interacting protein TIP120. Ubiquitously expressed in plant tissues throughout development. T-DNA insertion mutant plants were complet
cullin-associated and neddylation dissociated (CAND1); FUNCTIONS IN: binding; INVOLVED IN: xylem and phloem pattern formation, response to auxin stimulus, vegetative to reproductive phase transition of meristem; LOCATED IN: cell wall, plasma membrane; EXP
0
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os02g07120.1 HEAT repeat family protein, putative, expressed 0
 
Function (determined by interpro in EMBL-EBI)
Protein family membership

None predicted.

Domains and repeats
  1. Domain
  2. Domain
1 200 400 600 800 1000 1291
Detailed signature matches
    1. SSF48371 (ARM repeat)
    1. PF08623 (TIP120)
Unintegrated signatures no IPR
Unintegrated signatures
  1. PF13646 (HEAT_2)
  2. PTHR12696 (TIP120)
GO term prediction

Biological Process

None predicted.

Molecular Function

GO:0005488 binding

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
specific 219941 997 1131 2.48E-48 pfam08623 TIP120 cl07298 C
superfamily 219941 997 1131 2.48E-48 cl07298 TIP120 superfamily - C
multi-dom 222285 887 989 0.000249946 pfam13646 HEAT_2 - -
Conserved sites/feature
(0 result)
Type Brief name Coordinates Complete size Mapped size Source domain
 
DNA sequence
Upstream 1000 bp region from PH01000123G1430 gene.
ATCTTTGAGAAGCGTAACATGGGCAGGATTCGCGATAAAGGAAAGGGAAAATGCTTAGCTAGGGTTTCTCCTGCTTCCCTCCTCTCCCCGGCCGCCTCCCATCTCTACCTCTCCGGCGGGTGCTCACTTCTCCCGGCAACGGCGCCGCCACCGTCGCGCTGATCCACCCCCACTCTCCTCCGCTATCTGCTCCGCGCGTGGCGACCACGGAGGTCGCCGTGGTGTAGGGTTCGGGGGTTCTTCTGATCGGAGCTCGCGGTGGTAGTGGTGCCCGGCTTTCCGATCGGCCGCGTCCTCCGCTTCGCCGCCGACGAGCCGGTCGGATCGAGGGGAAGGAAAGTTATACTATCGCCGAGGGGAAGGAAAGGTATACTATCGCCATCCCCGTCCCCCCGTCGAGCGATTCGCCCACGGTATAGTTCTGCCGCTGTTTCATCTTCCGTCACCCTGAAGTACTAGTTGCGTAATGCTCGTGTGCTCGTGTGGGTTTTCGTTCCGATTAAGATTGGATTGCTTAGATACTAGCGCCGCGTGCTCCACTTCCGGATCTCTCACCCCTGGAACCGGAGATGGTGAAGCGGTCTGGGAGAGAAGTGTGACGGTAGATCGGTGCTTACGTGCGGTCAGTGTTGTACTGCAGCTTTCGAGATTAGATTCATAAGGCACTGCTTTCTGATGGATAAGAGCTTAACCTTATTTTTTCTGGATTTGACATGTATTGAGTTGGCAAAATCATTTTCTGTGAGGGATTTAGGTAGCTCGTTTTTGTTTCACCTGGAGCTTAGTTACGTGGCTACTAGAATCTCTTCTACTCCCATATGGTCTGACAGTGTTATGTTCTACGCCGATAATATACGTAAGGCGGCGAAGTTGTCAATAATTGCTGGTTGAAATTTTATATTTATGTTAATTTTGGTCTTTTGCCTGTCTACAAAAGTACAAATAGACAAGTGGTAGCATCTTCCTTTTTTGGCCACATGATAAGTATTCAATTGTTTTAT
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGGCAAATATGAACATAACCAACATCTTAGAGAAGATGACAGGGAAAGATAAAGATTACAGATATATGGCAACATCAGATCTGCTTAGTGAATTGAACAAAGAGGGTTTCAAAGCTGATCAAGACCTCGAGCCAAAGTTGACAAATATTGTTCTTCAACAACTGGAAGATGCTTCAGGAGATGTTTCTGGTTTAGCTGTGAAATGCTTGGCTCCACTTGTCAAGAAGGTTGGCGAGGACAGGGTAGTGGAGATGACCAACAAACTCTGTGATAAATTACTCAATGGAAAAGACCAGCATCGAGATACTGCTAGTATAGCTTTGAAGACAATCATTGTGGAAGTTACTACGACATCACTTGCTGAAAAGATTTTGGTTTCTCTTGCCCCACAGCTAATCAAGGGTGTCACCAATTCTGGGAAAAGTGCTGAAATTAAATGTGAATGTCTTGATATATTAGGGGATGTACTTCATAGATTTGGCAACTTGATCACAGAAGATCATGAGTATATGCTCATTGCACTTTTGTCACAGCTGAGCTCCAATCAAGCAAGCGTCAGAAAAAAGTCTATTTCTTGCATTGCATCGCTTGCTCCATGTTTGTCAGACGATTTATTAGCCAAGGCAACTTCGGAGGTTGTCCAATTGCTGAAAAATAGAAGTGCAAAATCTGAAATAACCCGGACAAATATCCAGATGATTGGTGCTCTAAGTCGTTCGGCCCTCGAGAGTTTTATGCTCAGGTGCCCAAGAGATATATCCCCATATTGTGAGGGTATTTTGAATCTTGCTTTGGAATATGTAAGCTATGATCCTAATTTCACCGATAGCATGGAGGAGGATACTGATGATGAAGGCCAGGATGAGGAAGATGATGATGAGAGTGCGAATGAATACACGGATGATGAGGATGCAAGCTGGAAAGTTCGTAGGGCATCAGCAAAGTGCCTATCTGCAATTATAGTATCTCGTCCTGAAATGTTGTCTAAGATGTATCAGGAGGCTTGTCCAAAGTTAATTGAACGATTTAGGGAAAGAGAGGAGAATGTAAAGATGGACATCTTCAACACGTTTATTGAGTTGTTACGCCAAACTGGCAATGTGACGAAAGGACAAGGTGACATTGATGAGTCCAGCCCTCGATGGTTGCTAAAACAAGAGGTACCCAAAGTTGTCAAGTCTATCAATAGGCAGTTCCGTGAAAAATCGATCAAGACAAAGGTTGGAGCATTCTCAGTATTGAAGGAGCTTGTTGTTGTACTACCAGACTGTCTTGCTGATCATTTTGGGTCACTTGTTCCTGGGATTGAGAAGGCTTTGAATGATAAATCGTCTACTTCCAACCTGAAAATTGAAGCCCTTGTATTTACAAGGCTTGTTATGAATTCACATTCACCCTCTGTGTTTCATCCATACATTCAGGCACTTTCTGGCCCAATATTATCTGCTATTGGAGATAGATATTACAAAGTCACCGCTGAGGCTTTACGGGCACGCTCTCTAGATTTCAGGCCATATATTGGTCCGATCTATAACGCTATATTGGCCCGCTTGGCTAATCAAGATCAAGATCAGGAGGTTAAAGAGTGCGCCATATCTTGCATGAGCCTTGTGGTCTCCACTTTTGGTGATAGTCTTCAAAGGGAATTACCATCATGCCTTCCCATACTTGTTGATAGGATGGGTAATGAAATAACAAGACTTACAGCGGTCAAGGCATTTGCGGTGATTGCCAATTCACCTCTTCGGATTGATCTTTCATGCGTCCTGGACCATGTCATTTCTGAGCTCACAGCTTTCCTTCGAAAGGCCAACAGAGCTCTTAGGCAGGCAACACTGGGAACACTAAATTCTCTGGTTGTCACATATGGTGGTCAAATTGGCTCGTCCTCTTATGAAACTATAATCGCTGAACTTTCTACCCTCATAAGTGACATGGATTTGCATATGACTGCTCTTGCACTGGAACTTTGTTGCACAATAATGGTTGACAGAAAATCCATTCAGAATGTTGGTTTAGCTGTGAGATATAAGGTTTTGCCTCAGGCCCTTATTTTGATCAGGAGTGCTCTCTTGCAAGGGCAAGCATTACAGGCGCTACAGAGATTTTTTGCTTCGCTGGTCCAGTATGCAAATACAAGCTTCGATACTTTGTTGGACTCTCTTATTTCTACTGCTAAACCATCACAGTCAGGTGGTCTTGCCAAGCAGGCGCTGTCTTCCATTGCACAATGTGTTGCTGTGCTATGCTTAGCAGCTGGTGATCAGAAGTGTGCATCAACTATTGAAATGCTTAAAGGCATCCTTAAAGACGACAGCGCTACTAATTCTGCTAAACAGCACATGGCCTTGCTATGTTTGGGAGAAATCGGAAGGAGGAAGGACCTCAGCAATCATGCTCAAATCGAAAATATTGTCATCGAGTCATTTCAATCACCTTTTGAGGAGATAAAGTCTGCAGCATCATATGCTCTTGGAAACATTGCTGTTGGCAATCTATCCAAGTATTTGCCATTTATCTTGGATCAGATTGACAATCAACAGAAGAAGCAATATCTTTTGCTTCATTCACTGAAAGAGGTTGATTTCTGTTGGAATTTGGTAATTGCACGACAGTCTGTTGATCATACTGGCCAGAGTGAGCTCCAGGATTCAAACATTGAGAAGATATTGGCATTGCTCTTTAATCACTGTGAAAGTGAGGAGGAAGGAGTTCGTAATGTAGTCGCGGAGTGTTTAGGCAAAATTGCTCTAATTGAACCTAAGAAATTAATCCCTGCTCTGAAGGAACGAACGTCTAGCCCAGCAGCAAACACAAGAGCTACAGTTGCCATTGCTATAAAATATTCTATTGTTGAACGGCCTGGAAAAATAGATGAAATCATGTACTCGGAGATTTCTACTTTCCTGATGTTAATTAAAGACAGTGACAGGCATGTGAGACGTGCGGCTGTCTTGGCTTTGAGTACTGCTGCACACAACAAGCCAAATTTGATTAAAGGTCTTCTTCCTGAATTATTGCCTCTTCTGTACGACCAAACTGTTGTGAAGCAAGAATTGATCAGGACAGTTGATCTAGGGCCTTTCAAGCATGTTGTAGATGACGGGCTTGAACTCAGGAAAGCTGCCTTTGAATGTGTGGACACATTGCTGGATAGTTGTCTTGATCAAGTGAATCCATCGTCCTTCATTGTTCCTTTCCTCTTATCTGGCTTAGGTGATCATTATGATGTAAAAATGCCTTGCCATCTGATTCTCTCAAAGCTAGCAGACAAGTGCCCTTCTGCAGTTCTTGCAGTTTTGGACTCATTAGTTGAACCTATTGAGAAAACTATTAGTCACAGACCCAAGGGCGATGCAGTGAAGCAGGAGGTTGATCGCAATGAAGACATGATTCGCAGTGCTCTCCGAGCAATTGCTGCGTTAAGCCGCATAAGTGGCAGTGACTACAGCATGAGGTTCAAGAATCTGATGAACAAGATAATGGCCTCTCCTCCACTTGCTGAGAAGTACAACTCAAGCTTTGGTTGTAACAATGCGCTTTTAAACGACAGCCGGTCAATCTGGACAACCACGACTCCGACCGTTGAGGATGTGTTTATCAGAGTAAGGAAATGTCTAGCGGATGGAGAGGTAGACCGCCGGCGGATTGTCGCAATAGACAATGGTGGAGCGCTGCACCGGGCTGTGAAGCTCGGCCAGGAGCTGTCGGACCAGGACGTCTCGGCCACGGCATTGGCAACCGTGTGGTATTCTGCCTCCGCGCTGAAGCGCGACACCGTCGTCTGGCTCTTGGAGGACCAAGAAACAAGGTTGTCCCCAAGAAACACACAGTATCCGGACGTGGAACGGCGAGTGTCCGAGCACCCAACCTAG
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01000123G1430 gene.
ATAAATCTGATGGAACAAACGAAGCTCGCAAACTGTTGAAACCACGCGAGTGAGGGGCCTGCTTTAATCCATAGAGAGATTTACTAAGGCGACAAACATGATAAGGATTAGAAGGGTCGACAACCTCATCAAATGTGTCGTGAAGAAAAGCATTTTTGACGTCCATTTGATGGATCGGTCCGGAGCGAGAAAGAGCCAAACTCGAAACAATACGGATGGTGGCTGGTTGGACGACCGGACTAAATATCTCATCAAAATCAATACCAGGCAATTGGGAGAATCCGCAAAGAACCCAGTGTGCCTTGTATCGAGATAGAGAGCCATCCGGATTATACTTGTGACAGTAAATCCATTTCCCGGAGACTACATTGGCATTAGAAGGAGGCGGAACGAGTGGCCATGTGCTGTTCTGGAGAAGAGCATTGTACTCATCGCGCATCGCAGCAAAGCCAATGGGGATCTTTTAAGGCGGAGCGATAAGTTTTTAGAATTGGGGGAATGGATCTGTCAGTGGCGGAGAGATTTAGATGCTCGCGTGGCGGCACAACAAGCCCGACCTTGCCACGTGTAACCATGGAATGGGTGGCAAGAGGAGGGTGGTGCCACTAGTGCTGTCGTGGTAGGGCCTGTGGGAATTGCGGCAGACTGCGCGCGGCACAGCTTGTGCGGCAGTCGCTGGAGTTGCCATGCTGGGAAGAGCATTTGTCGCGGCAGGAGAAGTTGTTGCCGTGGTTGCGGTCGCGGTAGGAGAATGTGCTGTTGTGGTAGGAAAATCTGTGAATGCAGCAGATGGGTCCTAAGCTGAGGCAGGCGATTATGGTTTACAAGTTTTGGAAGCGGAAGGACTAAACGGAAGTCGCACTTGATGCCCCAACTCGCAAGCATGACAAATAGTCGAGCCCGGCCGGTTTATTACATGAAATGTCGGGAGATGACGAAGAAAAACCGACATGCTATTATTTCCTAGATGGCCCGGTCGGTGATGCCATGTGTCAGTGGTG
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01000123 Download
Protein sequence
Protein sequence
MANMNITNILEKMTGKDKDYRYMATSDLLSELNKEGFKADQDLEPKLTNIVLQQLEDASGDVSGLAVKCLAPLVKKVGEDRVVEMTNKLCDKLLNGKDQHRDTASIALKTIIVEVTTTSLAEKILVSLAPQLIKGVTNSGKSAEIKCECLDILGDVLHRFGNLITEDHEYMLIALLSQLSSNQASVRKKSISCIASLAPCLSDDLLAKATSEVVQLLKNRSAKSEITRTNIQMIGALSRSALESFMLRCPRDISPYCEGILNLALEYVSYDPNFTDSMEEDTDDEGQDEEDDDESANEYTDDEDASWKVRRASAKCLSAIIVSRPEMLSKMYQEACPKLIERFREREENVKMDIFNTFIELLRQTGNVTKGQGDIDESSPRWLLKQEVPKVVKSINRQFREKSIKTKVGAFSVLKELVVVLPDCLADHFGSLVPGIEKALNDKSSTSNLKIEALVFTRLVMNSHSPSVFHPYIQALSGPILSAIGDRYYKVTAEALRARSLDFRPYIGPIYNAILARLANQDQDQEVKECAISCMSLVVSTFGDSLQRELPSCLPILVDRMGNEITRLTAVKAFAVIANSPLRIDLSCVLDHVISELTAFLRKANRALRQATLGTLNSLVVTYGGQIGSSSYETIIAELSTLISDMDLHMTALALELCCTIMVDRKSIQNVGLAVRYKVLPQALILIRSALLQGQALQALQRFFASLVQYANTSFDTLLDSLISTAKPSQSGGLAKQALSSIAQCVAVLCLAAGDQKCASTIEMLKGILKDDSATNSAKQHMALLCLGEIGRRKDLSNHAQIENIVIESFQSPFEEIKSAASYALGNIAVGNLSKYLPFILDQIDNQQKKQYLLLHSLKEVDFCWNLVIARQSVDHTGQSELQDSNIEKILALLFNHCESEEEGVRNVVAECLGKIALIEPKKLIPALKERTSSPAANTRATVAIAIKYSIVERPGKIDEIMYSEISTFLMLIKDSDRHVRRAAVLALSTAAHNKPNLIKGLLPELLPLLYDQTVVKQELIRTVDLGPFKHVVDDGLELRKAAFECVDTLLDSCLDQVNPSSFIVPFLLSGLGDHYDVKMPCHLILSKLADKCPSAVLAVLDSLVEPIEKTISHRPKGDAVKQEVDRNEDMIRSALRAIAALSRISGSDYSMRFKNLMNKIMASPPLAEKYNSSFGCNNALLNDSRSIWTTTTPTVEDVFIRVRKCLADGEVDRRRIVAIDNGGALHRAVKLGQELSDQDVSATALATVWYSASALKRDTVVWLLEDQETRLSPRNTQYPDVERRVSEHPT
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above