gene PH01000122G1000
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01000122:581992 - 589584(+ stand)   Name
Alternate name Locus tag PH01000122G1000
Length of gene 7593  bp Length of CDS 1581  bp
Product information
Feature type
CDS
Product name
NAC domain-containing protein 67
Alternate name
Molecular weight
(predicted)
58152.4451200002  kDa
Isoeletric point
(predicted)
8.07252120971679
Length
526  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
SNP ID Position Base in Scaffold Polymorphism
PH01SNP00942760 PH01000122:582451 G G_A
PH01SNP00942770 PH01000122:582478 A A_G
PH01SNP00942780 PH01000122:582983 C C_T
PH01SNP00942790 PH01000122:586582 G G_C
PH01SNP00942800 PH01000122:586637 C C_T
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_135169 10
Please click OG5_135169 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
(0 result)
Gene ID Short description Curator summary Computational description E-value
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os03g60080.1 NAC domain-containing protein 67, putative, expressed 2E-128
 
Function (determined by interpro in EMBL-EBI)
Protein family membership

None predicted.

Domains and repeats
1 50 100 150 200 250 300 350 400 450 500 526
Detailed signature matches
    1. SSF51445 ((Trans)gl...)
    1. SSF101941 (NAC domain)
    2. PS51005 (NAC)
    3. PF02365 (NAM)
Unintegrated signatures no IPR
Unintegrated signatures
  1. PTHR31719 (FAMILY N...)
GO term prediction

Biological Process

GO:0005975 carbohydrate metabolic process
GO:0006355 regulation of transcription, DNA-dependent

Molecular Function

GO:0003677 DNA binding
GO:0003824 catalytic activity

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
specific 216997 247 350 7.74E-54 pfam02365 NAM cl03558 -
superfamily 216997 247 350 7.74E-54 cl03558 NAM superfamily - -
Conserved sites/feature
(0 result)
Type Brief name Coordinates Complete size Mapped size Source domain
 
DNA sequence
Upstream 1000 bp region from PH01000122G1000 gene.
CCTCCGAGGATGGGGATCACAATGGTGGCAGCGGCGGCGTCAAAGGATGGCCGGAGGTGGCGCGCGCGGGCAAGGCGGCGCACGGGCGGCGCGAGCTGCTTGGGGCTGTGGCGCTTCGGCGGCAGCTGGCGGGAGGTGGTGTGAGCACGAGTACTGGCCAGGTGTGGGGAAGCCGTAGGCAAGCTCGTGGAAGCTAGGGAAGGGCCGAGGAGGCGGCGCAACGGCGGCCATGGCCGACGGGAGGGAGCTCGTGATGGCGCGGCTCTACGACGAGTAATCGACCGGAGCAATTGGGGGGAGAAGAGGGCGCCCTAGAATGCGAGATGACGTGGAAAGGGGGGCAAGAGGATGACCGGAGGTGGAGTTTGGCGATGGGACGGTGTGGCCGGCGGTGGGGAAGAAAGAGGAAGGGGCGGCTCGGGTTGCTTCTGCGCAGGGAGAAAGAAGGAGAAAGGGAGGAGGAAAAGGGGGAGCTGTTGCGCCTTTAAAGGGGGGAGGAGAGTAGCTCGGGGAGGAGCTGTGCACAGTAGGCCGGCATGGCCGTGGCAGGGCGTGTGCCGCCGGGATAGGCAGAGGGATGGGCGGCATGGGGGTGATGTGGGGAGGCCAGGGCATGGGGCGGGGGCGATTGGGAGCAGGAGGCAGCATGGGGGAAGGTTGCCATGGCGTGCAGCTTCAACGGAAAGAAACAAGCATGGGCAAAGGCCACGAGAGGAAGAAAAGCAGGAGAAAAGGGAGGAGAGAGAAAAAGAAAAGAAATCCAAAAAATTTTATAAAATACTTTGGAACCTGAATAGATCAAATAAAATAGTTTTGGATTTTTTTTGAACTTTATTTTAGCCATTTAAAATGTTTTTTTCTTCAGAAATTCAATTTAAGCTTTAAATTAAATCGATAACATCCAAGTGATTATTTTTATTTTTAAAGCTTCAAAAGGAATCCCCATTTTAAATTAAATAATTTAAATTAAATTTTTCAAAAAATAAAATAACTTTTGAGAA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGAAGGACAACGTCGCTCATCTACATCTTCCCTTGCTTCTCGTCGCTCTCCTCCTTTGCTGCCACTTGCCGCCCGTGGAGGCGCTTCTTCCTTGCCTCCACCTCCGCCCTCCTCTCGGGCATCCGACCTCTCCTCCTCCAGCCCGTGCCTGGCTCCAAATCCTCCCACCTCCACGCCTTCTCCTGGCTCGTGATCCCCAAGTTCATCACCGCCCCACTCGCCGCCTTCCCCTCCACCCTTCTCCCGCGGCCACCTCATCCTCCTCGTGCGCCCCCCGCGGCCTCCTCCTGCTCATCGACGCCCTCAAAGGCGCCGAGCGCCTCTCGCTCCCGCTCCCTTCGCCCCACTTCCCTTGCTGTGTGTCCCGCATGTTCCGCGCCGGCGCTGCGATGGGCCTCACCGTGTGCCGCACCTGGTCCTTCAACGACGACGGCTACAACGCCCTCCAGTTCGCCCCTGGCCGCTTCGACGAGCGCGTCTTCAAGGCGCTGGACCGGGTGGTCGCGGAGGCGCTGATGAACGAGTTCGGGCTGTCGCACATGGTGGAGGGCTTCGATCACTCGCACCGCAATGTCTTCTACAAGACCGTCTATGACATTGTCCACGAGTCACCCAGGAGGGGCGGCGCCGGTGCCGGTGCCTTCGTGTGGATCGACAGCAGGATCGACAGCACAGACACGGTGAGCGCGACGATTGCCGGGTCGGCCGTGAACATGGTCACCCACACGCCCCGCACGAGGAGGGCGGTGGGGCAGCGCCTGCCGGTGCCCATCATCGCCGAGGTCGACCTCTACAAGTTCGACCCCTGGGACCTGCCCGAGCGGGCGCTGTTCGGGGCCAGGGAGTGGTACTTCTTCACGCCCAGGGATCGCAAGTACCCCAACGGGTCGCGCCCCAACCGCGCCGCTGGGAACGGCTACTGGAAGGCCACCGGCGCCGACAAGCCCGTCGCGCCGCGGGGCCGCACCTTGGGGGTCAAGAAGGCGCTCGTCTTCTACGCCGGCAAGGCCCCCCGCGGGGTCAAGACCGACTGGATCATGCACGAGTACCGCCTCGCCGACGCCGGCCGCGCCGCCGCAGGTGCCAAGAAGGGATCCCTCAGGCTGGATGATTGGGTGCTGTGCCGGCTTTACAACAAGAAGAACGAGTGGGAGAAGATGCAGCTGGGGAAGGAGGCCGAGGAAGAGGCGTCGGACATGATCACCTCGCACTCCCACTCGCACTCGCAGTCCCACTCCCACTCGTGGGCCGAGACGCGCACGCCGGAGTCGGAGATCGTGGACAACGACCCGTTCCCGGAGCTGGACTCCTTCCCGGCGTTCCAGGACCAGGCTGCGCAGATGAATATGATGGTGCCCAAGAAGGAGCAGGACATGGTCGAGGGCGCGCAGAACGCCAGGAACGACCTGTTCGTGGACCTCAGCTACGACGACATACAGAGCATGTACAGCGGCCTTGACATGCTGCCGCCAGGGGACGACTTCTACTCGTCGCTCTTCGCGTCTCCGCGGGTCAAGACGAACCAGCCCGGCGCCGGCGCCGGCGCAGGCGCAGGCGATGGCGGCATGGCCCCCTTCTGA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01000122G1000 gene.
ATAAACAAAAACCCCAAATTCACCTTCTCCCTCCGTCCGTTTGAAACCTAAGCCACGCCCGCTCCTTCCTCCCGCGTAGGTGCCGTCCTCCTCCCTTCGGCGGCGTCATTTGTGCGGCTGTCCTCTTCCTCCCACCGTCACTATCGTCGTTCTCCGCTGCTTGTGCCGTTGCCACCGACCTCCCGCTCTCGTCGCCAACTCCATTTGTTCTTCTTTTTTAAATTGTTAATTTTTTTATTGTATACAGGAATTATTTATGTAGTTGCCTTAATTGTATATATGAATTATTTATGAGATTTTTTAATTGTTAATTATTTTTTCCTTTTTTATTGTGCCATTGCATTAATTGCCGTTAAGATTAACTTTTGTGCAAATTGTCATTAAAACTTACTTGTGTGTGGATTATTGTTAATTGTCGATAGTTGTCAAAGTACCATCAATTGTCATTAGTTATCGTTAATTGCTATCAATTATCGTTAATTTCTTTTTATTGTTAATTTTTTTTCTTTTTTTATTGTACAATTGCATTAATTGTCGTTAAGATTAACTTTGTGCAGATTGTCATTAATTGATGTCAACTATTATTAAGATTTACTTGTGTGTGGATTGTCGTTAATTGTCGATAGTTGTTATAAAGTGTTTTCAATTGTCGTTAATTGCCATTAAACAACATTAAACAAGCTATCATTCACCTTAAAGACATTTCTCAACTCAGAAGCTCCAGCCAACCTAACTATAATCCAGATTGTTTGACATTCAAACACCAAACATCTTTAGCTCAATCATTCAGTTTTGTTGGTAGCTGTTCTTCAGAAAAGCTACAACCATACCAAACAGGCCTAAACGTGGTGCTCACCTGAAGTGATTAGCCAGAGCTCACTCGATCTGAGTACGACCTTCTCGGATCTGATTTCCTTGAAACAGAGCATAATTCAGATACAATTTAAGCAGTGAATCAACCTTCTCTTGTGTTCTCTGCAATTTTGCCTTTTGATCGCTTG
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01000122 Download
Protein sequence
Protein sequence
MKDNVAHLHLPLLLVALLLCCHLPPVEALLPCLHLRPPLGHPTSPPPARAWLQILPPPRLLLARDPQVHHRPTRRLPLHPSPAATSSSSCAPRGLLLLIDALKGAERLSLPLPSPHFPCCVSRMFRAGAAMGLTVCRTWSFNDDGYNALQFAPGRFDERVFKALDRVVAEALMNEFGLSHMVEGFDHSHRNVFYKTVYDIVHESPRRGGAGAGAFVWIDSRIDSTDTVSATIAGSAVNMVTHTPRTRRAVGQRLPVPIIAEVDLYKFDPWDLPERALFGAREWYFFTPRDRKYPNGSRPNRAAGNGYWKATGADKPVAPRGRTLGVKKALVFYAGKAPRGVKTDWIMHEYRLADAGRAAAGAKKGSLRLDDWVLCRLYNKKNEWEKMQLGKEAEEEASDMITSHSHSHSQSHSHSWAETRTPESEIVDNDPFPELDSFPAFQDQAAQMNMMVPKKEQDMVEGAQNARNDLFVDLSYDDIQSMYSGLDMLPPGDDFYSSLFASPRVKTNQPGAGAGAGAGDGGMAPF
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above