gene PH01000115G1120
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01000115:746907 - 754161(+ stand)   Name
Alternate name Locus tag PH01000115G1120
Length of gene 7255  bp Length of CDS 3816  bp
Product information
Feature type
CDS
Product name
expressed_protein
Alternate name
Molecular weight
(predicted)
138540.61412  kDa
Isoeletric point
(predicted)
7.13129806518554
Length
1271  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
(0 result)
SNP ID Position Base in Scaffold Polymorphism
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_186368 2
Please click OG5_186368 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
(0 result)
Gene ID Short description Curator summary Computational description E-value
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os03g08740.1 expressed protein 0
 
Function (determined by interpro in EMBL-EBI)
Protein family membership
Domains and repeats
None predicted.
Detailed signature matches
Unintegrated signatures no IPR
Unintegrated signatures
  1. PTHR22050 (RW1 PROT...)
  2. PTHR22050:SF0 (SUBF...)
GO term prediction

Biological Process

None predicted.

Molecular Function

None predicted.

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
specific 204895 256 328 3.08E-19 pfam12371 DUF3651 cl13764 -
superfamily 204895 256 328 3.08E-19 cl13764 DUF3651 superfamily - -
Conserved sites/feature
(0 result)
Type Brief name Coordinates Complete size Mapped size Source domain
 
DNA sequence
Upstream 1000 bp region from PH01000115G1120 gene.
TACATCATCCCACCCTGCCATCAAATCCATGGTTGAGGCCCATTGAACCTAGAATACTCTGTTAAACTTTGATGTACGTTGATATGTACTTTGTTGGCGTGTGCTAGGGACTCACTTAATGTTATTTGCTTGAAATTGATTGTTGCCTTGCATTGCTTTTGGTTGCATGATGTTATGGCGCAACATGATTCACGTGTTACTTGTTTTTGTCTAGCTATGTTGTGATATTGTGTTGTGCGTGAAGGTTTTGCATGCAATTCCACATGTCGTGTTGTGCGTGGAGGTTTTGCGTGCCATTACACATGTCAGAACTCAAAATTGAACATGTTGCCACCAGGTTTGGAACTCATTTTGTTAAACAATAGTATGTATTCTATTTGAATTCGTAGTTAAGTATATTCATATAAAACATATGAATATGGGTGTGCTTTGAATTCTATTTTATTCGTTTTTATCGCTAACATCATCCCACCATTCCATCAAATCGTGTTGTGCGTGAAGGTTTTGTATGCAATTCCACGTGCCGTGTCTTGCGTGGAGATTTTGCTTGCTATTCCACATGTCAAAACTGAACGTGTTGCTGTCGGGATTGGCGTTGGAATTCATTTTGTTAAACAGCATATGTCATAGGATATTGAAATCTGTCCGAATAAGTACTGTTCTATTCGAATGTGTGTGTGCTTATATTTATCTAAAACATATGAATATGAACGTGCTTTCAATTCTATTCTATTCATTTTCACCACTTAAATCATCCCAACTCGGCACCAAAATCTATGGGGGGGGGGGGGGGGGGGGGGGGTCAGAGTGGAAGAGGCTATCGGTAGCACTGGAGCATCAATCACGAGGTTCTATGTGACAGTGAGAAATCCAATCTATTTTTGCAAATTCTCCGGTCGATTCATGAATCATGGCTAGCCGTTTCAATTCATGCATTCAATCTCACATAATCGCGTTTCACAGCCCAGGATACCCACAGGGGCAAAACAGTCATATTCAAA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGACCAGCCGCAGCCGCCGCTCTTCGCTGGCGGTGACTTCCGTTTCCTTAAGGCCCCTACGCTCCGCCGTCTCCTCTCCTCGGGGTTCCTTGCTTGCTCTGTGCTGCTTGTTCTTGGTCCTTGCTCTGTCCGTCTCGGCGGCGGTGGGGGTTTGCGTGGAGGAGAGTGATGACGACGGTCGCTGCCTCGGCTTCCGGGATGTGTGCGCTGACAGGAGTTCCTTCTGCTTCTCGTCCTCGGCGGTTCAGACTTTGCTTGCAAGCGAGGACGGCACCAAGGAGCCCGATTTGGAGGTGTCAAGGGACTGGGGACCATCACGGCCATTGGGCTTCCCGATGTCCGGCGGAGGCGTGGTAACTTGCTCGTCTGCAGACGCGATGATCACTCGGACTCGGGTGCGTAATGGGTTGGGGCGAGAGGGCAAGGATGGTGGGAGGTATAATGTGGCGTGGTGCCAGGCGCCGCTTGTGGCTGACAATTGGATGCGGGCATCGCATGGGGTGCCGCTGGAGTTGGATGGCACGGCCACAGATGTCAATCCAAATGGCCTTTACGGTTCCTCATCGATGTACGTGGAGATAAACCCGCCAGTGTTGGATTGGGGCAGGAGTAACTTGTATGCAGCCTCTATGGCCACCTTGACTGTGGTGAATTTGAACAATGACAGCGTCTTGCATGTCTATGAGCCATTCAGCTCTGATCCGCAGTTCTATGTGTATGGTTATGAGGATTTGGTGCTTCAGCCCGGAGAGAATGCATCGGTCAACTTCATATTCTTGCCAAAGTTGTTGGGCTCTTCATCAGCGCATTTGGTTTTGCAGACGGATTTTGGTGGATTCATTATACAAGCTAAGGGCATGGCTGTCAGGTCGCCCTATCAGATACTGCCACTGACTGGGATGGATGTCGTAATAGGTGGTCACCTGGAGAGGAACTTGTCGATACACAACCCTTTTGATGATTCTCTCTATGTCGAGGAAGTGGCTGTTTGGATGTCTGCATTTGAAAGCACAAAACAATCTTCTCACGTGGTTTGTCAGTTAGGCCTTTCAGATGAGGCATTGGAGTTAGCTTCTTTGAGTAGCCACTGGTATACAGCAAGCAGTACTGAATTTGGATGGCCAATGATCCATATTAGGCCTAGTGAGCAATGGGAGGTGCTACCTTCAGAAAGCAACACAGTTGTAGAGTTGAAATTGCAGCCTCTTTCGGAAAGAAAGGTGTTTGGTGCTATCTGCATGAAACTGCGCAATCGCATAACTGATACAATGGATACTGTTGTTATACCTATTGAGCTAGAGGTGCATGCACGAACCTACTATGATTCCACTAGATTAGTTTCTGTCACGTTTGAGCGTATATCATCTTGTGCTGGAAGTGGGTCAATATTTTCCCTTTCTTTACGGAATGATGCAACAAAGTTACTGAGGATTGTAAGCGTGAGTGAGGATAACAGGGATGGCCCAGTGATCTTTCAGGTTAAGTACCTGAATGGATTGATACTCTTCCCTGATACCATAACAGATATAGCTTTGATAAGATATACTTCTTCAGTTCCAAAGGATATTTCATTTGACAACTGCAATATAGTGGTAGAAACAAATAGCTCTCTTGGTAGTTCAATCGTGATACCCTGCCAAGATATAATGTGTGCATCTCTTTCTCATACAACTAGTGCTGTTGTTGCTGAATCTGATGTACCATTTGTTGGACCGTTTTCTGAAGAAGAGACATCTGCTAACTCAAGGACGGGATCTTTGGGCAGCATCCTAGAAATAGAAGGCCTGCATAACTTGAAGGCTGTCCGCCGCCATCGCGCCGCCTCCTACAAGGCACGGCGGCGGCGGCCCGCGCATGCCCACGAGACGACGGTGGTGGCACCCTGTTGCAGTGGTGACGACGGTGATGGGCGTATCGAGGGGGGGCAGCGGTGGCAGCAGCCAACAATCATGAGAGCAGTCAGAGCTGATGATATGTTTTCAAAATGGATAACCATCCATAACCCAAGCCTGGAGCATACATCCATGCAGCTGGTACTGAACTCTGAGGAAATAATTGGCCAGTGCAAAACTGTAAATGACGCATGTGAACACACATTCTCAAGTAGATCTCCGGAAATTGACTCGACAGAGACTAAATTTGGTTTCTCATTAAGTGATGCAGCAATTACTGAGGCCTATGTTGGTCCTTTGGAGAGTGCTTTACTTGGTCCTATTGTCTTCCGTCCCTCAAATCGGTGCATGTGGTCTAGCATGGTTTTGATCAGAAACAATCTATCGGGCATGGAGCGGCTGCCTCTTCGAGCTCATGGTGGATGGCAATCTATTGCCCTTCTAGAGGGACCTGAACCTATTTGGAAGCTAGAGTTTAACCATGGGTCCACTGTCCACAATAAATCAACACTCTCCAAATCAGAGATCACCAGCCCTTTGTGCAGTCAACAGTTGTCCAAGGAGATACATGTTAAAAATAGTGGTGACCTACCTCTTCGAGTGACAAAGGTAAAAGTTTCTGGAGTTGATTGTGGTGTGGATGGATTTACGGTGGACAACTGCAAGGGATTTAGCTTAGCACCAAGTGAATCGATAAGAATGCTAATTTCTTTTAAAGCTGACTTCTCTTCAGCTAAGGTCCAGAGAGATCTTGAGCTAGCTATGACTACTGGCATCTTTGTGATCCCGATGACTGCAAATGTTCCAGTCTGTATGCTTAACCAGTGCAGAAAGTTTTACCTCAGATCCATCAATTGGAAAGCATTCATACTATTTTTCGGAACTGTGTCCTTGTTTGTTCTGGTCTTTGTCCGTGGTGTCCCTTCTTTGCCAGTGGGCTCTCAAGATTACTATATCAAGATTGATGGCAGGAAAGGTACCATTAGCAAGGCTGTTAAACCCTCTGTCCTTCAGCGTACCGACAAAACTTCCAGGTTGACAAGGGAACACAAAAGAGCTGAAGAAGCTCTTACTGAGAAATACACTGCTAATATTCTTGATAGCCCCAAGAAGACATGTGACAAGAACAATCCAGATGAACAACTGAATACAACTTCGGCTATATCTGTGTCCCCAGCTAATCCTGTGGAAGACAAGGTATCAATGGAAGCTCCACAAACTAGTGGGAATCTTACTATCAGAGTTGCTCGAGACAAAAGGAGGCGAAGGAAGCGGAAAGTTGGTGGTGCAGGACTGGCAGGAATGTTTGAGGTTTCTAGCAGCCACAGCGGGAATTCAACACCGTCTTCGCCGTTATCACCAAGTTCAACCCCAAAACATGGTTGGTCCTTTCCTGGGGCACCATCAGAACTGAAGCACAACAATAAACTCGAGAGTTGTTTTGATGTTGAGGCAAGGGCACCATCAACTGGGAATAACTATGAGAAGAATGCTTGGTTGCAAACTGCCAAGGAGCAACCTCCTGCACCTTCAGCAACATCTGGAAATCCATTGCCTTCAGCCACTGTGCTGACCACCGCATGGCGCTCACCATTGTTGGCCACATCTTCCCCAATCGCTCCGCACGCTCGCGCTCCTGGCTCCAACCTGATGAAAGACAAGGCTGTGAAGAGAAAAGGGGAAGTCGCGCCGAAGAAAGAGTTCACATATGACATATGGGGAGATCATTTCTCTGGACATCTGCTGGGGAAAGCGAGGGAGGTCGCGCCATGCAAGATGTTTAATGCTTCTGAAGGGGCCTCCAATAGCTTCTTTGCAAGAGAGCCCCAGACCCTCATGATGAAGTCGTCATCTGCACCACCCGTGTCTCGTGGCCGCGGATCGCTGCCGTCTGATGTAGCGTCTAGCTATGAAATAAATTAA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01000115G1120 gene.
ATAAAAAACTGAGGTACATAATATATTACTGTATTTAAGAATATTTTTTTTAAAAAAAAAAAAAACACTAGATGATGAGTCTCCAGCTGATGATTCTAAAGGTGATGTCTCACTTTACTGCCGTCGAATCGAAGACATAACGAGAACATATACGCCTGTCTAAAGCAGGAGAGGTGCTTCATGCAGACCTCTATTTTATTGGGGATGACTCATTCATAAGTGCCAAAAATGCGCACTTTGTGTACCACGTGCAGATTAGGCAGACAGTTTGAAGGAGATGCCTCGCCTGTGGATGCCAATAATACCCTCTCTTGGTAATATCTCTCTCTCTCTTTTTTTTTTGAAACGAAGGTAATATCTCTACTTTAACTCTAAAGGCCTTTTTTTTTTCTTGCAAATTCACTGTTCACCCTTGTTTTATTCGTTGCCATTCTCCCCGCCACAAAGCATCATGAGGCTTCCTTCGTGAAGAACATCCTAACACCAAAGGTTACTTGCAGGGGTTGCAATAGCTCTGAAATCCGACGGATCACCAGGGGCTACTAGAACTGAATAACAGAGGGGCAGAACATGGAAGGGAATAGTAGCAGGTCACATCCAAGAGCACGTTCTCTTATTATTACGTGTATACCAAAAGCCAGTGATTTTCAGAATATACACATCATCTGGCACTCTAAAATGGTTTATTTGATACAATACATTGCTTGCTTCTCGATCCAGGAATTCTGCATTCCACTTCAGAATGGAGACAATTTCCAGCCAATCACTTCGAGTTGAAGAGTGGCAATCTGCAATATGCAAAATTCATATCATGAATGCCCATTTCTATGCTCATTACATCACCAACCTCTAGTTTTTCTTTCAATAATTTCAGATAGGACTTGGCTTGAGATGAAGTAGGAACACCTGAAGATATGGTGCATCTAGCAAGAACTCACCAGAGCCTGAGCGACGTATCAGAGCTGTCTTCGGTGTCGAGTGGAGCGCGCGGATACGACGCA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01000115 Download
Protein sequence
Protein sequence
MTSRSRRSSLAVTSVSLRPLRSAVSSPRGSLLALCCLFLVLALSVSAAVGVCVEESDDDGRCLGFRDVCADRSSFCFSSSAVQTLLASEDGTKEPDLEVSRDWGPSRPLGFPMSGGGVVTCSSADAMITRTRVRNGLGREGKDGGRYNVAWCQAPLVADNWMRASHGVPLELDGTATDVNPNGLYGSSSMYVEINPPVLDWGRSNLYAASMATLTVVNLNNDSVLHVYEPFSSDPQFYVYGYEDLVLQPGENASVNFIFLPKLLGSSSAHLVLQTDFGGFIIQAKGMAVRSPYQILPLTGMDVVIGGHLERNLSIHNPFDDSLYVEEVAVWMSAFESTKQSSHVVCQLGLSDEALELASLSSHWYTASSTEFGWPMIHIRPSEQWEVLPSESNTVVELKLQPLSERKVFGAICMKLRNRITDTMDTVVIPIELEVHARTYYDSTRLVSVTFERISSCAGSGSIFSLSLRNDATKLLRIVSVSEDNRDGPVIFQVKYLNGLILFPDTITDIALIRYTSSVPKDISFDNCNIVVETNSSLGSSIVIPCQDIMCASLSHTTSAVVAESDVPFVGPFSEEETSANSRTGSLGSILEIEGLHNLKAVRRHRAASYKARRRRPAHAHETTVVAPCCSGDDGDGRIEGGQRWQQPTIMRAVRADDMFSKWITIHNPSLEHTSMQLVLNSEEIIGQCKTVNDACEHTFSSRSPEIDSTETKFGFSLSDAAITEAYVGPLESALLGPIVFRPSNRCMWSSMVLIRNNLSGMERLPLRAHGGWQSIALLEGPEPIWKLEFNHGSTVHNKSTLSKSEITSPLCSQQLSKEIHVKNSGDLPLRVTKVKVSGVDCGVDGFTVDNCKGFSLAPSESIRMLISFKADFSSAKVQRDLELAMTTGIFVIPMTANVPVCMLNQCRKFYLRSINWKAFILFFGTVSLFVLVFVRGVPSLPVGSQDYYIKIDGRKGTISKAVKPSVLQRTDKTSRLTREHKRAEEALTEKYTANILDSPKKTCDKNNPDEQLNTTSAISVSPANPVEDKVSMEAPQTSGNLTIRVARDKRRRRKRKVGGAGLAGMFEVSSSHSGNSTPSSPLSPSSTPKHGWSFPGAPSELKHNNKLESCFDVEARAPSTGNNYEKNAWLQTAKEQPPAPSATSGNPLPSATVLTTAWRSPLLATSSPIAPHARAPGSNLMKDKAVKRKGEVAPKKEFTYDIWGDHFSGHLLGKAREVAPCKMFNASEGASNSFFAREPQTLMMKSSSAPPVSRGRGSLPSDVASSYEIN
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above