gene PH01000093G0340
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01000093:219867 - 223295(+ stand)   Name
Alternate name Locus tag PH01000093G0340
Length of gene 3429  bp Length of CDS 870  bp
Product information
Feature type
CDS
Product name
no apical meristem protein
Alternate name
Molecular weight
(predicted)
32502.7235199999  kDa
Isoeletric point
(predicted)
8.17869186401367
Length
289  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
(0 result)
SNP ID Position Base in Scaffold Polymorphism
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_164225 5
Please click OG5_164225 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
Gene ID Short description Curator summary Computational description E-value
AT3G12977.1
NAC (No Apical Meristem) domain transcriptional regulator superfamily protein
NAC (No Apical Meristem) domain transcriptional regulator superfamily protein; FUNCTIONS IN: DNA binding; INVOLVED IN: regulation of transcription; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: No apical meristem (NAM) protein (Inter
5E-84
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os06g46270.1 no apical meristem protein, putative, expressed 2E-132
 
Function (determined by interpro in EMBL-EBI)
Protein family membership

None predicted.

Domains and repeats
  1. Domain
1 50 100 150 200 250 289
Detailed signature matches
    1. SSF101941 (NAC domain)
    2. PS51005 (NAC)
    3. PF02365 (NAM)
Unintegrated signatures no IPR
Unintegrated signatures
  1. PTHR31427 (FAMILY N...)
GO term prediction

Biological Process

GO:0006355 regulation of transcription, DNA-dependent

Molecular Function

GO:0003677 DNA binding

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
specific 216997 6 135 3.90E-69 pfam02365 NAM cl03558 -
superfamily 216997 6 135 3.90E-69 cl03558 NAM superfamily - -
Conserved sites/feature
(0 result)
Type Brief name Coordinates Complete size Mapped size Source domain
 
DNA sequence
Upstream 1000 bp region from PH01000093G0340 gene.
TACAGTGACTCCTGTTCTTCTTGGGAAGATGCCAAGAATGTAGCTATCGGTGCAGTGCTGCAAGAAGAGATCATGTGATGGGCAAAAGATAGTGTACTCACTCCATGGATCGTTAAAAATGATAGAATAATTTGTTCAGAAATGCCCAGAGAGCTGATCTTTCAATTGATCGAACGGTTCGCGTTGATCGTTTCCGTCGCCCATTTCGTGCCGATCGATCATGCACTGTGTGGTGCGTGCAAAGGCCAAAGCCATGCCCAGAGTTCATGAGTTCTGCCTGCGACGTCAGAGTATCAGACGCGTTTACAGAATGCTATGCGGTGGACGAAGTACCAGCCGAGAACTGCGAATTATTCAGTCATTGAAATGGATCCAATTCTTGCTCATTAGGACCTGCTTTTCCTTCTGAACTATTTCAAATTTGGAATGGTCAGCCCATAGAAACTGCTTATGTCAGACGCAACGCGTGCTTTGGAACAGAGGTGCCAGTTCATCTTGCAGGTTTTTAGATTATTCCATTTGATTTGAAGTTTTGAACAATGTCTAAATGTTCCGGAATCTGGGTTTGATGCCTTGCATAGAGTCATAGACCCCGCAGAGTCTTCTAGGATATACATTATACGGTAGTTCAGTACTGCTAAAAGGCAAAGTTCTTCAGCGACCTTTGTGATTCGTTAAAAAAGTGTAACAAATTAAACCGTTCTCTGCCGAAGAAAAGCATGTGTAACTACCTGAGTCTCTCTCTCTCTCTCTCCCCCCGCAAAAGCACATTTCTTCACTTGTACTCCTTTACATATTAACACTGCATTGTCATTTGTCCCTTCAAAAACAAAACACTGCATTGCCTATGAAAGCTTTTCTTGATTCTTACTTACATGATAATTGAGTATTAATTCTCGCTGAATGGCAGCATCAGGGAGGGAATTTGCAGGTTAAGAGGGACCCCCCAAAAGCATGCCACGTCTGTCGTCTGGCAGTCAAGTGTACCTATAGATGCTGCC
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGGTGGAGGCAAGGCTGCCTCCCGGGTTTAGATTCCATCCTCGAGACGATGAGCTCGTGATTGACTACCTGTCGAAGAAGCTCGGCGGCGGCGCGGCGGGCGTCTACGGCTGCCCTACGTTGGTCGACGTCGATCTGAACAAGTGCGAGCCTTGGGACCTTCCAGCAATCGCGTGTGTCGGTGGGAAAGAGTGGTATTTCTACAGCATCAAGGACAGGAAGTATGCCACCGGCCAACGAACAAACAGAGCGACTGAATCAGGCTACTGGAAGGCCACCGGGAACGACCGGGAAGTAAGGCGGAAAGGGTTGCTTGTTGGCATGCGCAAGACCCTCGTGTTCTACCGAGGAAGAGCTCCCAAGGGGAACAGGACTGATTGGGTCATGCATGAGTTCCGGAAGGAGCAAGGCGATCATCATCAGATGAAGTCGCCTCTCAAGGAGGACTGGGTCCTGTGTAGAGTTTTCTACAAGAGCAGTACAGCAGTTGCAATTCAAACAATGGAGAATACTTCTTACACCAATGGAACATCGCCATCTCAATTGCCTCCCCGCGTCGACAGCTCCATCTCCTTCAATCATTCCGGCGTGGCGCGGAACCTTGAGGCTTATGAGCAAGTGCCCTGCTTCTCTAGCTCCCCTCAGCCATCACCAACGATGAATACGCCGTCGATACCGGCCGTAGACTTGTTTGAAGGGCAACATGCAGGGAAGGCAATCAAAGATGTTCTGAGCCAGTTCACTGGGTTTGAAGGCCTTGCAGTGAAAAGAGAGGTGCCTCTGCAGGGTTTGGATCAGGATGGATTCGAGAGTTACTACTATCTAACCGAGAATGGTTCCTCACAAACATGGAACTCATTCATGATTTGA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01000093G0340 gene.
ATAAAAAAACGTCGATCTAACTGCCGTCCCGTCCAACACCGCCTGTTAGACTTCATTGTCTTAGTCGTCACGCCATCCAATGCTGCCTATCGATGGATTTAGTTCCATCATCTATGATCTCATTCTTGGGAACGAAGCTCCATGGGACGAACTACAGGTTGTGGTCTTCACTCATGGAGATCACGCTGGATGGTCTCTGCCTCTAGGGACATGTCATTGGTACTCGACCTTATCTGCTGTTACCAGTTCAGCCTCCTCCCAGACAGCGTACTTCTGCACCTCCTGCAGAAGATGCGGCCACCAAGAAGGAGGCAGAGGCTGGTGCCGCCGCCACCGTTGTTGACACTGCTGATGAGACCTTTCAGTATGCCATAGATACCTTTGAGCACTGGTGTGCTGATGAGGCCCGTGTTCGAGCCATCCTGGTGGTCATTGTCGATGAATCCATCTAGCCAGACATTGTTAGTCTGTGTTCCACTCATCAAATCTGGGAGTATTTACGCGAGCGATACCATCAGAGCTGCGATATCTTCAGTTCTTTTCACTTCAGCGTAAGTTAGAGATGCTTCACCAAGAGGACTTCTCTATCGATGACTTCTTCCGAGCCTTGTCCAGTCTCTGGTGCCAGCTAGACGAGCTGGCTTCTCCGCTCTGCCAGGATTGTCATAAGACGTAGAAGGAAGATCATGACAGCCTTTGCCTTTATGACTTCGTCTGCCATTTTCGCCCAGAGTTTGAGCCTATCAGGGCTCAACTGCTGAGCCACTCACCATAACTGACAGTCACCGAGGCTCTTTTGACGCTTCATGCTAAGGAGCTTCACCACGGGTTAGCAGCACAGTTTGTTTTGGCTGTACTTGCTACCCCTTCTTCTTCGACTATACCGACGACTTTTGCTTAGACTACAATTTCTCCTTATGTGTCTGTTTTCGCTCATGTTTTTTTTTACCAATTGGGGTTCAGTGCAATTATTGCAAGAACTTCGGGCATGACTACCAGAG
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01000093 Download
Protein sequence
Protein sequence
MVEARLPPGFRFHPRDDELVIDYLSKKLGGGAAGVYGCPTLVDVDLNKCEPWDLPAIACVGGKEWYFYSIKDRKYATGQRTNRATESGYWKATGNDREVRRKGLLVGMRKTLVFYRGRAPKGNRTDWVMHEFRKEQGDHHQMKSPLKEDWVLCRVFYKSSTAVAIQTMENTSYTNGTSPSQLPPRVDSSISFNHSGVARNLEAYEQVPCFSSSPQPSPTMNTPSIPAVDLFEGQHAGKAIKDVLSQFTGFEGLAVKREVPLQGLDQDGFESYYYLTENGSSQTWNSFMI
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above