gene PH01000091G0440
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01000091:255117 - 260234(+ stand)   Name
Alternate name Locus tag PH01000091G0440
Length of gene 5118  bp Length of CDS 1296  bp
Product information
Feature type
CDS
Product name
WD-40 repeat family protein
Alternate name
Molecular weight
(predicted)
48206.1638200001  kDa
Isoeletric point
(predicted)
5.21104049682617
Length
431  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
(0 result)
SNP ID Position Base in Scaffold Polymorphism
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_134008 10
Please click OG5_134008 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
Gene ID Short description Curator summary Computational description E-value
AT1G78070.1
Transducin/WD40 repeat-like superfamily protein
Transducin/WD40 repeat-like superfamily protein; CONTAINS InterPro DOMAIN/s: WD40 repeat 2 (InterPro:IPR019782), WD40 repeat-like-containing domain (InterPro:IPR011046), WD40 repeat, conserved site (InterPro:IPR019775), WD40-repeat-containing domain (Inte
0
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os03g26870.1 WD-40 repeat family protein, putative, expressed 0
 
Function (determined by interpro in EMBL-EBI)
Protein family membership

None predicted.

Domains and repeats
  1. Domain
  2. Repeat
1 50 100 150 200 250 300 350 400 431
Detailed signature matches
    1. SSF50978 (WD40 repe...)
    2. PS50294 (WD_REPEATS...)
    1. PS50082 (WD_REPEATS_2)
    2. SM00320 (WD40)
    3. PF00400 (WD40)
    1. PS00678 (WD_REPEATS_1)
Unintegrated signatures no IPR
Unintegrated signatures
  1. PTHR22847 (WD40 REP...)
GO term prediction

Biological Process

None predicted.

Molecular Function

GO:0005515 protein binding

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
non-specific 238121 211 411 2.82E-24 cd00200 WD40 cl02567 C
superfamily 243092 211 411 2.82E-24 cl02567 WD40 superfamily - C
non-specific 238121 201 411 8.76E-19 cd00200 WD40 cl02567 -
non-specific 238121 207 361 7.84E-18 cd00200 WD40 cl02567 N
non-specific 238121 294 411 1.08E-12 cd00200 WD40 cl02567 C
non-specific 238121 207 330 6.33E-12 cd00200 WD40 cl02567 N
non-specific 197651 291 330 4.56E-07 smart00320 WD40 cl02567 -
non-specific 201208 292 330 7.81E-07 pfam00400 WD40 cl02567 -
multi-dom 225201 210 411 8.52E-20 COG2319 COG2319 - NC
multi-dom 225201 182 411 3.56E-15 COG2319 COG2319 - N
multi-dom 225201 183 340 4.25E-12 COG2319 COG2319 - N
multi-dom 225201 244 411 4.77E-12 COG2319 COG2319 - C
multi-dom 225201 210 399 1.33E-09 COG2319 COG2319 - N
multi-dom 227282 249 377 0.00176746 COG4946 COG4946 - NC
Conserved sites/feature
Type Brief name Coordinates Complete size Mapped size Source domain
generic structural tetrad N214,A236,D240,F246,D247,V277,S281,A287,D288,G300,H301,A318,D323,W329,D330,R344,A361,A366,Y372,D373,D385,L386,V405,D409 40 24 238121
 
DNA sequence
Upstream 1000 bp region from PH01000091G0440 gene.
TCCCTGCCCACCCTCCTACCAGCGGCTCCAGCAGCATCACCGCGGCTGCCGCCCACCGTCGTGCTCTCCCTCCCTCTAAGCTCGGGCTCCAGTGAACTCAAACCCTAATAGTGAAGTTGAGCCCTGACCCAACGACGTTATAGGGGAGGAAGACGAGCTCATCGGAGCACGAATCTCAATACAAGATCGAAATGTTAGAAAATCGACCGGAAGTTAAGAGATTTTCGATTGCTTGTGCACTAGCAAAACCGTTAAAAATAAGCACCGTAAACACCGAACTTTGCCTAATTAGGCTACCTCCTCACAACCACTTAACTAAAATTTGGAGCTCTTTTACAATACACTCAATTTAATACGGCCCATCTGTTCTCTTTGATCTAATAATTCATATTAGTTAGGATTTAGTTATACTACACCTGGTAGTATGTGTAGTAGTAGAATCTTAATGGAGGTAGAATTGTAATTGGCCATATGTGTGTGTGGGGCCGAGGGGAGGATCACATGCCACAATAGTAATATTTTCAACAATAGTTGGAGAAATCTATAATACCCTCACGAAAAATTATAAATACAAAGAAAAATCTATTATATCATTAACAAATCAATATTCATATTTAATTTATACTATCGCCCTATGCTAGCAGTAGAATATATAGTAGAATTAATAAAAATCTTTGTCTCAGAATAGTTGTTGCTTTAGCGGTGCTTCAGCACGTAGCACCACGCCCTGTAGCTTTGCGACTGCCACCGCATTGCACGAGGATTGAGAAAAAGAAGAAGCGTGTCGAGCCGTACGAGGAGGCAGGCAAACGAGGCAACGCATGCACCGATCCGAACAGTGTCGTGGCAAACCGCGAGGGGCCAGGGCGCGAATCTCCACGCACGCAGCAGCCGTACACCCGCATGCAAGCTGACGTGCGGTGGCCGGTGGCCTGAGCGCAAGGCAACTCCGTCGTAAACGCCGACCCGAGGGAAACGGCAGGTAGCCACCGCCCGCGCGC
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGGCGCAAGACCTGCACGACGACTTGGAGTTCGTCGCCTCCGACGGCGACTACGACTTCGAGTTCGATGATGCGGGCGGCGCTTCTGCTTCCCACATGGATAAGCAGATGGATGATACTTCAGCCTCAGAGTATAAAGTGGGGAAAGACATGCAAGGGATACCCTGGGAAAGGTTAAATTATAGTAGGGATCAGTACCGTGAGATGAGGCTGAAACAATACAAGAACTACGAGAGCCTCGCTATGTCGCGAGAGGGACTAGAAAAGGAATGCAAAGGAGTGGAGAGAAAAGACACATTCTATGATTTTCACTTGAATACAAGATTTGTCAAGCCAACAATAGTGCATTTTCAGCTGAGGAATCTTCTGTGGGCTTCTTCCAAGCATGATGTGTACGTGATGCAGAACTTTTCTGTCATGCACTGGTCATCTCTGCTTCAGAGGGGAAAAGAAGCTCTCAATGTGGCAGGCCAAGTAGTTCCAACTCAGGATGTCCGCGGAGCTCGGCCATTGTCGAGGGTGCAGATCAGCACCATGGCACTGAAGGACAATCTCATGGTGGCTGGTGGTTTCAAGGGGGAACTTATCTGCAAGTATGTTGATCGACCCGGAGTGGCGTTCTGTACGAGTCTAACGGGCAATAACAATTCCATCACCAATGCCGTTGATATCTACCAGTCTCCGAACGGCGCTACTCGAGTTATGGCTGCGAACAACGACTGCATTGTTAGAACTTTTGATACCGAGAAATATAGCCTCCTTAGCCAGTTCCCTTTTCCATGGTCTGTCAATAATACATCAGTGAGTCCTGACGGCAAGCTACTCGCAGTTCTTGGCGATAGCTCTGACTGCTTGATAGCTGATTCACAATCTGGCAAGGAAATCGCGAGCCTGGAAGGTCACCTTGACTACTCGTTCTCGTCGGCGTGGCACCCCGACGGCCGCGTCCTCGCAACCGGGAACCAGGACACGACGTGCCGGCTATGGGACGTGCGCAACTTATCACAGTCGTTCGCGGTCCTCAAGGGGAGGATCGGCGCCATCAGGGGCCTCAAGTACTCGCCGGACGGCCGGTTCCTGGCCCTGTCGGAGCCGGCGGACTTCGTCCACGTGTACGACGCCTCGGCCGGGTACTGCGCCGCGCAGGAGATCGACCTCTTCGGGGAGATCGCCGGCGTGGCGTTCAGCCCGGACGACGCCGAGGCGCTGTTCGTGGGCATCGCCGACAGGACATACGGCAGCCTGCTCGAGTTCCGCAGGCGGCGCCTGCACGATTACCTGGACTGCTACCTCTGA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01000091G0440 gene.
ATAAAGTCACCACTTTTTTTTTAATCTTATACTACTCATTACTATTCACTAGGACTTGATTATTATTATTATTTAGAGGGAATCACTAGGACTTGATACCCAACCCACATAATCTTGGGCTGGGCCGCCCAGCCCAGAGGTGGTATCTTTCTCACTTTGTCACTTGTCATAGTGTGCAGTAGCAATTGGAATGTTGGATACCTCAAGTTTGCGGATGCAAAGGTCAAAGCTAAGGGGGTGTAAATGGAGCAGATAGTTCTCGACCGTCTGTTTGTCCAAATAAATTTGGATCTTATTCTGAGCCTGAAACTAGATATCCGGGATTTTTCTCAGATTTCGGATTCGAAGCCGGATAGTTTTTACCGGATACGGAAACGAATTCGGGAAGGAGATATCCGTCGGATTCAGAGCTATCCAGATAATTTATCGGATAGTATTTGGTAAATACTATTTTGGGTATCCGGTAAACTCTAGGCCTAGTGGGCCGGATAGAGAAATAGGCCTATGAGGATTTCCAGTATTTAATTATTATTATTATTTTTAGAAAAATACAAGAAATCCAAATAAGCCAAGAAAAATAGCAATTGAACTCGGAAAAATTCCAGAAAATTTACAAAAATACTTTGGAACATAAGGAACTTAAATAAAATATTTTTGAATTTAATAGATGTTTGATTTATTCATATTAAATCATTTTAATTTCTAAAAAAAAATCTATTTAAGCTTTGTTAAATTATAGAAAACCATGAAAATTTTACAAAACCCTATTTTAAATAAAATATTTCTAAAAACTTGAAAATTGTGATGCTACAGACTTTCTACCAGTTAACGTTCTGTGTATCCCTAACTGGTTATTGATACTGGTCTATAGGCTGTATATATTGTACATGTCTTATTATGTAGTTGGCTAGTCACATTTTGCACATCTTTTGTACTGCTATCGCTATAACTTGCTACTTGCTACTACTTCTTTAACTCGTCGCCGTGATGGTGTGATGTAG
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01000091 Download
Protein sequence
Protein sequence
MAQDLHDDLEFVASDGDYDFEFDDAGGASASHMDKQMDDTSASEYKVGKDMQGIPWERLNYSRDQYREMRLKQYKNYESLAMSREGLEKECKGVERKDTFYDFHLNTRFVKPTIVHFQLRNLLWASSKHDVYVMQNFSVMHWSSLLQRGKEALNVAGQVVPTQDVRGARPLSRVQISTMALKDNLMVAGGFKGELICKYVDRPGVAFCTSLTGNNNSITNAVDIYQSPNGATRVMAANNDCIVRTFDTEKYSLLSQFPFPWSVNNTSVSPDGKLLAVLGDSSDCLIADSQSGKEIASLEGHLDYSFSSAWHPDGRVLATGNQDTTCRLWDVRNLSQSFAVLKGRIGAIRGLKYSPDGRFLALSEPADFVHVYDASAGYCAAQEIDLFGEIAGVAFSPDDAEALFVGIADRTYGSLLEFRRRRLHDYLDCYL
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above