gene PH01000068G0320
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01000068:227296 - 233269(+ stand)   Name
Alternate name Locus tag PH01000068G0320
Length of gene 5974  bp Length of CDS 1809  bp
Product information
Feature type
CDS
Product name
CAMK_CAMK_like.36 - CAMK includes calcium/calmodulin depedent protein kinases
Alternate name
Molecular weight
(predicted)
66359.5416200002  kDa
Isoeletric point
(predicted)
8.16032028198242
Length
602  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
SNP ID Position Base in Scaffold Polymorphism
PH01SNP00573670 PH01000068:229913 C C_T
PH01SNP00573680 PH01000068:230416 T T_C
PH01SNP00573690 PH01000068:230522 C C_G
PH01SNP00573700 PH01000068:230557 T T_C
PH01SNP00573710 PH01000068:230634 A A_G
PH01SNP00573720 PH01000068:230963 G G_A
PH01SNP00573730 PH01000068:231984 T T_A
PH01SNP00573740 PH01000068:232631 C C_T
PH01SNP00573750 PH01000068:232691 G G_C
PH01SNP00573760 PH01000068:232796 C C_T
PH01SNP00573770 PH01000068:232877 G G_A
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_131734 8
Please click OG5_131734 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
Gene ID Short description Curator summary Computational description E-value
AT2G41140.1
CDPK-related kinase 1
Encodes CDPK-related kinase 1 (CRK1).
CDPK-related kinase 1 (CRK1); FUNCTIONS IN: calcium-dependent protein serine/threonine phosphatase activity, calmodulin-dependent protein kinase activity, kinase activity, calcium ion binding; INVOLVED IN: protein amino acid phosphorylation, N-terminal pr
0
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os07g44710.1 CAMK_CAMK_like.36 - CAMK includes calcium/calmodulin depedent protein kinases, expressed 0
 
Function (determined by interpro in EMBL-EBI)
Protein family membership

None predicted.

Domains and repeats
1 100 200 300 400 500 602
Detailed signature matches
    1. SSF56112 (Protein k...)
    1. PF00069 (Pkinase)
    2. PS50011 (PROTEIN_KI...)
    1. SM00220 (S_TKc)
    1. PS00107 (PROTEIN_KI...)
    1. PS00108 (PROTEIN_KI...)
Unintegrated signatures no IPR
Unintegrated signatures
  1. PTHR24349 (SERINE/T...)
  2. SSF47473 (EF-hand)
GO term prediction

Biological Process

GO:0006468 protein phosphorylation

Molecular Function

GO:0004672 protein kinase activity
GO:0004674 protein serine/threonine kinase activity
GO:0005509 calcium ion binding
GO:0005524 ATP binding
GO:0016772 transferase activity, transferring phosphorus-containing groups

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
non-specific 173660 229 446 3.95E-55 cd05123 STKc_AGC cl09925 -
superfamily 245201 229 446 3.95E-55 cl09925 PKc_like superfamily - -
non-specific 173623 231 445 1.57E-52 cd00180 PKc cl09925 -
non-specific 173755 231 447 3.33E-48 cd08215 STKc_Nek cl09925 -
non-specific 173672 230 446 1.15E-46 cd05581 STKc_PDK1 cl09925 -
non-specific 173659 231 446 1.30E-44 cd05122 PKc_STE cl09925 -
non-specific 173669 229 447 4.64E-44 cd05578 STKc_Yank1 cl09925 -
non-specific 173724 230 447 4.68E-44 cd06606 STKc_MAPKKK cl09925 -
non-specific 173731 229 447 2.00E-42 cd06627 STKc_Cdc7_like cl09925 -
non-specific 173670 223 449 1.84E-41 cd05579 STKc_MAST_like cl09925 -
non-specific 173671 230 448 7.13E-41 cd05580 STKc_PKA cl09925 -
non-specific 173663 231 446 3.53E-38 cd05572 STKc_cGK_PKG cl09925 -
non-specific 132954 233 452 6.06E-38 cd06623 PKc_MAPKK_plant_like cl09925 -
non-specific 173733 235 447 1.37E-37 cd07829 STKc_CDK_like cl09925 -
non-specific 173734 235 446 1.01E-36 cd07830 STKc_MAK_like cl09925 -
non-specific 132963 229 447 1.98E-36 cd06632 STKc_MEKK1_plant cl09925 -
non-specific 173737 235 463 1.29E-35 cd07834 STKc_MAPK cl09925 -
non-specific 132957 229 447 1.68E-35 cd06626 STKc_MEKK4 cl09925 -
non-specific 143333 235 447 4.13E-34 cd05118 STKc_CMGC cl09925 -
non-specific 173702 230 449 8.14E-34 cd05611 STKc_Rim15_like cl09925 -
non-specific 132940 230 460 1.05E-33 cd06609 STKc_MST3_like cl09925 -
non-specific 143346 235 450 1.18E-33 cd07841 STKc_CDK7 cl09925 -
non-specific 173691 233 449 2.11E-33 cd05600 STKc_Sid2p_Dbf2p cl09925 C
non-specific 173728 235 450 2.64E-33 cd06614 STKc_PAK cl09925 N
non-specific 173736 235 446 8.33E-33 cd07832 STKc_CCRK cl09925 -
non-specific 143338 231 446 9.81E-33 cd07833 STKc_CDKL cl09925 -
non-specific 173665 223 451 1.04E-32 cd05574 STKc_phototropin_like cl09925 -
non-specific 173664 249 449 5.48E-32 cd05573 STKc_ROCK_NDR_like cl09925 -
non-specific 173661 230 449 6.49E-32 cd05570 STKc_PKC cl09925 -
non-specific 132991 230 460 7.53E-32 cd06917 STKc_NAK1_like cl09925 -
non-specific 132942 230 460 1.41E-31 cd06611 STKc_SLK_like cl09925 -
non-specific 132979 246 460 1.91E-31 cd06648 STKc_PAK_II cl09925 N
non-specific 173761 232 445 2.92E-31 cd08221 STKc_Nek9 cl09925 -
non-specific 173725 230 447 1.05E-30 cd06608 STKc_myosinIII_like cl09925 -
non-specific 143345 218 447 1.47E-30 cd07840 STKc_CDK9_like cl09925 -
non-specific 173674 231 446 1.78E-30 cd05583 STKc_MSK_N cl09925 -
non-specific 173726 228 447 2.94E-30 cd06610 STKc_OSR1_SPAK cl09925 -
non-specific 173739 235 446 6.73E-30 cd07838 STKc_CDK4_6_like cl09925 -
non-specific 132952 235 459 3.09E-29 cd06621 PKc_MAPKK_Pek1_like cl09925 -
non-specific 173771 231 445 6.11E-29 cd08529 STKc_FA2-like cl09925 -
non-specific 173757 236 447 1.02E-28 cd08217 STKc_Nek2 cl09925 -
non-specific 173681 230 436 8.24E-28 cd05590 STKc_nPKC_eta cl09925 C
non-specific 173703 230 448 2.24E-27 cd05612 STKc_PRKX_like cl09925 -
non-specific 173723 235 447 3.94E-27 cd06605 PKc_MAPKK cl09925 -
non-specific 173683 236 448 4.90E-27 cd05592 STKc_nPKC_theta_delta cl09925 C
non-specific 143341 222 446 5.11E-27 cd07836 STKc_Pho85 cl09925 -
non-specific 132943 230 447 1.08E-26 cd06612 STKc_MST1_2 cl09925 -
non-specific 173662 236 448 1.20E-26 cd05571 STKc_PKB cl09925 C
non-specific 173732 230 447 1.29E-26 cd06628 STKc_MAPKKK_Byr2_like cl09925 -
non-specific 132974 230 447 1.32E-26 cd06643 STKc_SLK cl09925 -
non-specific 173675 234 448 2.50E-26 cd05584 STKc_p70S6K cl09925 -
non-specific 173686 236 451 3.75E-26 cd05595 STKc_PKB_beta cl09925 C
non-specific 173692 233 428 4.17E-26 cd05601 STKc_CRIK cl09925 C
non-specific 173682 236 456 5.75E-26 cd05591 STKc_nPKC_epsilon cl09925 -
non-specific 173727 230 445 5.97E-26 cd06613 STKc_MAP4K3_like cl09925 -
non-specific 132969 231 447 7.26E-26 cd06638 STKc_myosinIIIA cl09925 N
non-specific 173677 235 449 1.37E-25 cd05586 STKc_Sck1_like cl09925 C
non-specific 132960 230 447 2.39E-25 cd06629 STKc_MAPKKK_Bck1_like cl09925 -
non-specific 132990 246 447 2.70E-25 cd06659 STKc_PAK6 cl09925 N
non-specific 173689 249 448 2.83E-25 cd05598 STKc_LATS cl09925 -
non-specific 173741 235 447 3.01E-25 cd07843 STKc_CDC2L1 cl09925 -
non-specific 173704 227 457 3.24E-25 cd05613 STKc_MSK1_N cl09925 -
non-specific 173770 229 391 6.16E-25 cd08528 STKc_Nek10 cl09925 C
non-specific 173673 233 439 7.41E-25 cd05582 STKc_RSK_N cl09925 C
non-specific 143356 235 448 7.53E-25 cd07851 STKc_p38 cl09925 -
non-specific 132988 246 450 9.19E-25 cd06657 STKc_PAK4 cl09925 N
non-specific 173758 231 447 1.33E-24 cd08218 STKc_Nek1 cl09925 -
non-specific 173744 235 446 1.99E-24 cd07847 STKc_CDKL1_4 cl09925 -
non-specific 173705 221 454 2.30E-24 cd05614 STKc_MSK2_N cl09925 C
non-specific 173762 236 447 2.31E-24 cd08222 STKc_Nek11 cl09925 -
non-specific 173747 235 458 2.36E-24 cd07852 STKc_MAPK15 cl09925 -
non-specific 173759 229 443 3.59E-24 cd08219 STKc_Nek3 cl09925 -
non-specific 173678 230 436 3.60E-24 cd05587 STKc_cPKC cl09925 C
non-specific 132978 246 465 3.61E-24 cd06647 STKc_PAK_I cl09925 N
non-specific 173680 230 455 3.72E-24 cd05589 STKc_PKN cl09925 C
non-specific 173685 236 436 4.25E-24 cd05594 STKc_PKB_alpha cl09925 C
non-specific 173709 236 448 4.59E-24 cd05619 STKc_nPKC_theta cl09925 C
non-specific 173738 225 446 4.66E-24 cd07835 STKc_CDK1_like cl09925 -
non-specific 173760 236 445 6.66E-24 cd08220 STKc_Nek8 cl09925 -
non-specific 132989 246 450 7.54E-24 cd06658 STKc_PAK5 cl09925 N
non-specific 173684 236 436 8.71E-24 cd05593 STKc_PKB_gamma cl09925 C
non-specific 132956 236 447 9.82E-24 cd06625 STKc_MEKK3_like cl09925 N
non-specific 132970 231 448 1.40E-23 cd06639 STKc_myosinIIIB cl09925 N
non-specific 143361 225 447 1.47E-23 cd07856 STKc_Sty1_Hog1 cl09925 -
non-specific 173749 235 447 1.62E-23 cd07855 STKc_ERK5 cl09925 -
non-specific 143359 224 447 2.66E-23 cd07854 STKc_MAPK4_6 cl09925 -
non-specific 173772 231 445 2.87E-23 cd08530 STKc_CNK2-like cl09925 -
non-specific 173742 235 459 3.55E-23 cd07845 STKc_CDK10 cl09925 -
non-specific 173700 249 442 4.14E-23 cd05609 STKc_MAST cl09925 N
non-specific 132968 231 447 4.52E-23 cd06637 STKc_TNIK cl09925 -
non-specific 173687 246 451 5.56E-23 cd05596 STKc_ROCK cl09925 N
non-specific 132975 230 454 5.91E-23 cd06644 STKc_STK10_LOK cl09925 -
non-specific 173711 236 451 6.59E-23 cd05621 STKc_ROCK2 cl09925 N
non-specific 173688 255 428 6.98E-23 cd05597 STKc_DMPK_like cl09925 NC
non-specific 132986 231 451 7.12E-23 cd06655 STKc_PAK2 cl09925 N
non-specific 132971 230 447 8.17E-23 cd06640 STKc_MST4 cl09925 -
non-specific 173690 233 448 1.01E-22 cd05599 STKc_NDR_like cl09925 -
non-specific 143344 235 446 1.41E-22 cd07839 STKc_CDK5 cl09925 -
non-specific 173751 219 446 1.44E-22 cd07860 STKc_CDK2_3 cl09925 -
non-specific 173750 235 447 1.91E-22 cd07857 STKc_MPK1 cl09925 -
non-specific 173712 236 451 2.37E-22 cd05622 STKc_ROCK1 cl09925 N
non-specific 88519 230 449 2.63E-22 cd05618 STKc_aPKC_iota cl09925 -
non-specific 132962 223 447 2.70E-22 cd06631 STKc_YSK4 cl09925 -
non-specific 132987 248 461 3.53E-22 cd06656 STKc_PAK3 cl09925 N
non-specific 173714 249 449 4.12E-22 cd05625 STKc_LATS1 cl09925 -
non-specific 173693 233 438 4.15E-22 cd05602 STKc_SGK1 cl09925 C
non-specific 132985 248 451 4.95E-22 cd06654 STKc_PAK1 cl09925 N
non-specific 132967 231 447 6.19E-22 cd06636 STKc_MAP4K4_6 cl09925 -
non-specific 173721 255 449 6.69E-22 cd05632 STKc_GRK5 cl09925 N
non-specific 173710 236 448 8.16E-22 cd05620 STKc_nPKC_delta cl09925 C
non-specific 143376 235 446 8.49E-22 cd07871 STKc_PCTAIRE3 cl09925 -
non-specific 132972 230 460 8.65E-22 cd06641 STKc_MST3 cl09925 -
non-specific 173765 231 447 9.63E-22 cd08225 STKc_Nek5 cl09925 -
non-specific 173764 223 443 1.11E-21 cd08224 STKc_Nek6_Nek7 cl09925 -
non-specific 143354 235 447 1.56E-21 cd07849 STKc_ERK1_2_like cl09925 -
non-specific 173676 255 446 1.78E-21 cd05585 STKc_YPK1_like cl09925 C
non-specific 173752 218 446 1.92E-21 cd07861 STKc_CDK1_euk cl09925 -
non-specific 132973 230 447 2.58E-21 cd06642 STKc_STK25-YSK1 cl09925 -
non-specific 173743 235 446 5.15E-21 cd07846 STKc_CDKL2_3 cl09925 -
non-specific 173748 228 448 5.67E-21 cd07853 STKc_NLK cl09925 C
non-specific 173694 246 438 8.32E-21 cd05603 STKc_SGK2 cl09925 C
non-specific 143342 235 446 1.04E-20 cd07837 STKc_CdkB_plant cl09925 -
non-specific 132953 249 447 1.10E-20 cd06622 PKc_MAPKK_PBS2_like cl09925 N
non-specific 143378 235 446 1.44E-20 cd07873 STKc_PCTAIRE1 cl09925 -
non-specific 173718 249 448 1.51E-20 cd05629 STKc_NDR_like_fungal cl09925 -
non-specific 132982 236 446 2.23E-20 cd06651 STKc_MEKK3 cl09925 -
non-specific 173706 236 440 2.31E-20 cd05615 STKc_cPKC_alpha cl09925 C
non-specific 132938 231 460 2.50E-20 cd06607 STKc_TAO cl09925 -
non-specific 173708 230 436 2.90E-20 cd05617 STKc_aPKC_zeta cl09925 C
non-specific 173763 235 447 3.36E-20 cd08223 STKc_Nek4 cl09925 -
non-specific 143377 235 449 5.86E-20 cd07872 STKc_PCTAIRE2 cl09925 -
non-specific 132983 236 447 9.19E-20 cd06652 STKc_MEKK2 cl09925 -
non-specific 143384 235 446 1.01E-19 cd07879 STKc_p38delta_MAPK13 cl09925 -
non-specific 173754 235 446 1.03E-19 cd07865 STKc_CDK9 cl09925 -
non-specific 132949 248 448 1.68E-19 cd06618 PKc_MKK7 cl09925 N
non-specific 88524 255 456 1.88E-19 cd05623 STKc_MRCK_alpha cl09925 N
non-specific 173713 255 434 2.32E-19 cd05624 STKc_MRCK_beta cl09925 NC
non-specific 173730 240 447 2.70E-19 cd06624 STKc_ASK cl09925 N
non-specific 173666 246 438 3.50E-19 cd05575 STKc_SGK cl09925 C
non-specific 132964 231 460 3.68E-19 cd06633 STKc_TAO3 cl09925 N
non-specific 143349 226 446 4.20E-19 cd07844 STKc_PCTAIRE_like cl09925 -
non-specific 132961 230 448 5.61E-19 cd06630 STKc_MEKK1 cl09925 -
non-specific 143382 235 446 6.55E-19 cd07877 STKc_p38alpha_MAPK14 cl09925 -
non-specific 173768 208 435 7.03E-19 cd08228 STKc_Nek6 cl09925 -
non-specific 173668 255 449 7.78E-19 cd05577 STKc_GRK cl09925 N
non-specific 173707 236 436 8.78E-19 cd05616 STKc_cPKC_beta cl09925 C
non-specific 143385 235 446 1.00E-18 cd07880 STKc_p38gamma_MAPK12 cl09925 -
non-specific 173716 230 426 1.02E-18 cd05627 STKc_NDR2 cl09925 C
non-specific 173715 249 427 1.14E-18 cd05626 STKc_LATS2 cl09925 C
non-specific 173753 218 447 1.29E-18 cd07864 STKc_CDK12 cl09925 -
non-specific 173695 236 456 1.51E-18 cd05604 STKc_SGK3 cl09925 -
non-specific 132951 235 457 1.88E-18 cd06620 PKc_MAPKK_Byr1_like cl09925 -
non-specific 173679 230 449 2.45E-18 cd05588 STKc_aPKC cl09925 -
non-specific 173717 249 427 2.72E-18 cd05628 STKc_NDR1 cl09925 C
non-specific 143371 235 446 2.81E-18 cd07866 STKc_BUR1 cl09925 -
non-specific 173624 225 403 2.92E-18 cd00192 PTKc cl09925 -
non-specific 173696 255 460 4.08E-18 cd05605 STKc_GRK4_like cl09925 N
non-specific 132976 232 446 4.43E-18 cd06645 STKc_MAP4K3 cl09925 -
non-specific 132984 236 447 7.91E-18 cd06653 STKc_MEKK3_like_1 cl09925 N
non-specific 173769 193 435 7.92E-18 cd08229 STKc_Nek7 cl09925 -
non-specific 143368 235 447 9.50E-18 cd07863 STKc_CDK4 cl09925 -
non-specific 143383 235 446 1.05E-17 cd07878 STKc_p38beta_MAPK11 cl09925 -
non-specific 132946 235 452 1.95E-17 cd06615 PKc_MEK cl09925 -
non-specific 143363 235 447 2.48E-17 cd07858 STKc_TEY_MAPK_plant cl09925 -
non-specific 173720 236 460 5.00E-17 cd05631 STKc_GRK4 cl09925 -
non-specific 173729 248 452 5.93E-17 cd06617 PKc_MKK3_6 cl09925 N
non-specific 132966 231 460 1.00E-16 cd06635 STKc_TAO1 cl09925 N
non-specific 173735 235 446 1.10E-16 cd07831 STKc_MOK cl09925 -
non-specific 132965 231 460 1.64E-16 cd06634 STKc_TAO2 cl09925 -
non-specific 173745 231 445 1.70E-16 cd07848 STKc_CDKL5 cl09925 -
non-specific 173697 238 436 2.13E-16 cd05606 STKc_beta_ARK cl09925 -
non-specific 173746 235 448 2.41E-16 cd07850 STKc_JNK cl09925 -
non-specific 143381 235 447 5.93E-16 cd07876 STKc_JNK2 cl09925 -
non-specific 173722 238 436 1.14E-15 cd05633 STKc_GRK3 cl09925 -
non-specific 173637 227 402 2.04E-15 cd05059 PTKc_Tec_like cl09925 -
non-specific 143380 235 447 3.56E-15 cd07875 STKc_JNK1 cl09925 -
non-specific 173719 255 449 3.57E-15 cd05630 STKc_GRK6 cl09925 N
non-specific 143367 235 446 1.15E-14 cd07862 STKc_CDK6 cl09925 -
non-specific 173740 291 446 1.34E-14 cd07842 STKc_CDK8_like cl09925 N
non-specific 173699 236 448 1.60E-14 cd05608 STKc_GRK1 cl09925 -
non-specific 143379 235 447 1.61E-14 cd07874 STKc_JNK3 cl09925 -
non-specific 133199 225 389 1.68E-14 cd05068 PTKc_Frk_like cl09925 C
non-specific 132977 246 444 2.14E-14 cd06646 STKc_MAP4K5 cl09925 N
non-specific 143375 235 446 2.50E-14 cd07870 STKc_PFTAIRE2 cl09925 -
non-specific 133243 227 395 4.29E-14 cd05112 PTKc_Itk cl09925 -
non-specific 143374 235 449 5.15E-14 cd07869 STKc_PFTAIRE1 cl09925 -
non-specific 132981 235 451 5.81E-14 cd06650 PKc_MEK1 cl09925 -
non-specific 173658 227 401 6.12E-14 cd05114 PTKc_Tec_Rlk cl09925 -
non-specific 173698 249 445 8.87E-14 cd05607 STKc_GRK7 cl09925 -
non-specific 173626 222 380 1.63E-13 cd05034 PTKc_Src_like cl09925 C
non-specific 133180 212 390 4.34E-13 cd05049 PTKc_Trk cl09925 -
non-specific 143364 235 453 1.04E-12 cd07859 STKc_TDY_MAPK_plant cl09925 -
non-specific 132980 235 405 1.52E-12 cd06649 PKc_MEK2 cl09925 C
non-specific 132947 248 456 6.45E-12 cd06616 PKc_MKK4 cl09925 N
non-specific 133186 236 440 2.80E-11 cd05055 PTKc_PDGFR cl09925 N
non-specific 133248 231 401 3.59E-11 cd05148 PTKc_Srm_Brk cl09925 -
non-specific 173657 236 389 4.52E-11 cd05113 PTKc_Btk_Bmx cl09925 C
non-specific 173641 227 401 8.83E-11 cd05072 PTKc_Lyn cl09925 -
non-specific 133171 246 378 1.68E-10 cd05039 PTKc_Csk_like cl09925 NC
non-specific 133172 229 404 2.39E-10 cd05040 PTKc_Ack_like cl09925 -
non-specific 173650 229 404 4.65E-10 cd05094 PTKc_TrkC cl09925 -
non-specific 143373 291 394 7.55E-10 cd07868 STKc_CDK8 cl09925 NC
non-specific 132950 249 448 8.01E-10 cd06619 PKc_MKK5 cl09925 N
non-specific 173630 246 393 8.99E-10 cd05044 PTKc_c-ros cl09925 N
non-specific 173645 235 389 9.12E-10 cd05084 PTKc_Fes cl09925 C
non-specific 173644 230 383 9.51E-10 cd05079 PTKc_Jak1_rpt2 cl09925 C
non-specific 143372 291 394 9.70E-10 cd07867 STKc_CDC2L6 cl09925 NC
non-specific 173633 227 389 1.76E-09 cd05052 PTKc_Abl cl09925 C
non-specific 133187 246 389 1.86E-09 cd05056 PTKc_FAK cl09925 NC
non-specific 173649 229 404 2.24E-09 cd05093 PTKc_TrkB cl09925 -
non-specific 133202 225 378 3.82E-09 cd05071 PTKc_Src cl09925 C
non-specific 173701 249 359 3.97E-09 cd05610 STKc_MASTL cl09925 C
non-specific 173628 232 389 6.27E-09 cd05038 PTKc_Jak_rpt2 cl09925 C
non-specific 133216 236 380 8.96E-09 cd05085 PTKc_Fer cl09925 C
non-specific 133232 230 389 1.06E-08 cd05101 PTKc_FGFR2 cl09925 NC
non-specific 133200 225 387 1.17E-08 cd05069 PTKc_Yes cl09925 C
non-specific 173667 248 446 3.07E-08 cd05576 STKc_RPK118_like cl09925 -
non-specific 173648 229 390 3.77E-08 cd05092 PTKc_TrkA cl09925 -
non-specific 133165 246 401 4.21E-08 cd05033 PTKc_EphR cl09925 N
non-specific 133191 235 377 4.94E-08 cd05060 PTKc_Syk_like cl09925 C
non-specific 133212 223 382 9.08E-08 cd05081 PTKc_Jak2_Jak3_rpt2 cl09925 C
non-specific 133213 236 380 1.09E-07 cd05082 PTKc_Csk cl09925 C
non-specific 173634 232 389 1.47E-07 cd05053 PTKc_FGFR cl09925 NC
non-specific 173639 231 401 1.93E-07 cd05066 PTKc_EphR_A cl09925 -
non-specific 173701 350 445 2.40E-07 cd05610 STKc_MASTL cl09925 N
non-specific 173656 260 389 2.47E-07 cd05111 PTK_HER3 cl09925 NC
non-specific 173636 225 389 2.80E-07 cd05057 PTKc_EGFR_like cl09925 C
non-specific 240159 231 338 2.96E-07 cd05120 APH_ChoK_like cl17270 N
superfamily 247824 231 338 2.96E-07 cl17270 APH_ChoK_like superfamily - N
non-specific 133240 262 389 3.47E-07 cd05109 PTKc_HER2 cl09925 NC
non-specific 173652 230 389 3.77E-07 cd05100 PTKc_FGFR3 cl09925 C
non-specific 133201 231 387 4.53E-07 cd05070 PTKc_Fyn_Yrk cl09925 C
non-specific 173654 295 389 4.85E-07 cd05108 PTKc_EGFR cl09925 NC
non-specific 173640 246 399 5.75E-07 cd05067 PTKc_Lck_Blk cl09925 N
non-specific 133194 310 401 7.09E-07 cd05063 PTKc_EphR_A2 cl09925 N
non-specific 173638 310 401 1.01E-06 cd05065 PTKc_EphR_B cl09925 N
non-specific 133229 230 389 1.03E-06 cd05098 PTKc_FGFR1 cl09925 NC
non-specific 173629 235 389 1.04E-06 cd05041 PTKc_Fes_like cl09925 C
non-specific 88330 232 393 1.12E-06 cd05047 PTKc_Tie cl09925 C
non-specific 133235 234 389 1.52E-06 cd05104 PTKc_Kit cl09925 N
non-specific 133211 221 383 1.73E-06 cd05080 PTKc_Tyk2_rpt2 cl09925 C
non-specific 133214 246 433 2.03E-06 cd05083 PTKc_Chk cl09925 N
non-specific 133204 227 401 2.16E-06 cd05073 PTKc_Hck cl09925 -
non-specific 173756 239 389 2.30E-06 cd08216 PK_STRAD cl09925 C
non-specific 133220 232 393 3.00E-06 cd05089 PTKc_Tie1 cl09925 C
non-specific 133234 288 389 7.11E-06 cd05103 PTKc_VEGFR2 cl09925 N
non-specific 173655 237 389 7.59E-06 cd05110 PTKc_HER4 cl09925 C
non-specific 133230 230 389 1.22E-05 cd05099 PTKc_FGFR4 cl09925 C
non-specific 173625 248 389 1.59E-05 cd05032 PTKc_InsR_like cl09925 NC
non-specific 133179 214 390 1.61E-05 cd05048 PTKc_Ror cl09925 -
non-specific 237847 234 345 1.69E-05 PRK14879 PRK14879 cl17178 NC
superfamily 237847 234 345 1.69E-05 cl17178 PRK14879 superfamily - NC
non-specific 133233 288 389 2.03E-05 cd05102 PTKc_VEGFR3 cl09925 N
non-specific 133181 310 393 2.46E-05 cd05050 PTKc_Musk cl09925 N
non-specific 173632 229 389 3.17E-05 cd05051 PTKc_DDR cl09925 NC
non-specific 133221 232 412 3.53E-05 cd05090 PTKc_Ror1 cl09925 -
non-specific 173635 310 389 3.93E-05 cd05054 PTKc_VEGFR cl09925 N
non-specific 133219 232 393 4.77E-05 cd05088 PTKc_Tie2 cl09925 C
non-specific 133246 231 389 5.65E-05 cd05115 PTKc_Zap-70 cl09925 C
non-specific 133178 232 389 0.000106298 cd05046 PTK_CCK4 cl09925 C
non-specific 133168 231 393 0.000160022 cd05036 PTKc_ALK_LTK cl09925 -
non-specific 133247 260 380 0.000187534 cd05116 PTKc_Syk cl09925 NC
non-specific 133238 296 389 0.000234377 cd05107 PTKc_PDGFR_beta cl09925 N
non-specific 214801 274 451 0.000353497 smart00750 KIND cl09925 -
non-specific 173631 309 389 0.000415783 cd05045 PTKc_RET cl09925 NC
non-specific 133227 229 389 0.000700866 cd05096 PTKc_DDR1 cl09925 NC
non-specific 133175 295 377 0.000837117 cd05043 PTK_Ryk cl09925 NC
non-specific 173767 240 389 0.0011967 cd08227 PK_STRAD_alpha cl09925 C
non-specific 133189 307 389 0.00367128 cd05058 PTKc_Met_Ron cl09925 NC
non-specific 173647 222 389 0.00407636 cd05091 PTKc_Ror2 cl09925 C
non-specific 133195 246 401 0.00443696 cd05064 PTKc_EphR_A10 cl09925 N
non-specific 173653 296 389 0.0072308 cd05105 PTKc_PDGFR_alpha cl09925 N
non-specific 223584 309 350 0.00976097 COG0510 ycfN cl17270 NC
multi-dom 214567 230 447 4.11E-83 smart00220 S_TKc - -
multi-dom 215690 233 447 5.15E-74 pfam00069 Pkinase - -
multi-dom 223589 229 463 1.64E-45 COG0515 SPS1 - C
multi-dom 140289 230 436 7.14E-26 PTZ00263 PTZ00263 - C
multi-dom 173616 230 455 1.31E-24 PTZ00426 PTZ00426 - N
multi-dom 177649 222 453 2.27E-23 PLN00009 PLN00009 - -
multi-dom 140293 234 442 1.47E-21 PTZ00267 PTZ00267 - NC
multi-dom 240233 235 449 5.16E-21 PTZ00024 PTZ00024 - N
multi-dom 197581 225 390 5.83E-21 smart00219 TyrKc - C
multi-dom 173502 236 449 1.07E-20 PTZ00266 PTZ00266 - C
multi-dom 215036 231 451 1.14E-20 PLN00034 PLN00034 - N
multi-dom 214568 225 390 9.89E-20 smart00221 STYKc - C
multi-dom 234389 234 442 1.75E-19 TIGR03903 TOMM_kin_cyc - C
multi-dom 219530 225 377 2.88E-19 pfam07714 Pkinase_Tyr - C
multi-dom 240344 255 445 4.01E-16 PTZ00283 PTZ00283 - NC
multi-dom 223069 246 449 4.04E-13 PHA03390 pk1 - N
multi-dom 173333 220 464 2.98E-12 PTZ00036 PTZ00036 - -
multi-dom 183880 235 442 8.66E-10 PRK13184 pknD - C
multi-dom 177557 272 383 1.70E-09 PHA03209 PHA03209 - NC
multi-dom 165473 235 404 1.08E-08 PHA03207 PHA03207 - NC
multi-dom 215638 279 448 1.31E-07 PLN03225 PLN03225 - N
multi-dom 165476 225 378 6.41E-07 PHA03210 PHA03210 - NC
multi-dom 223009 296 450 9.20E-06 PHA03211 PHA03211 - N
multi-dom 140307 271 447 6.44E-05 PTZ00284 PTZ00284 - N
multi-dom 178763 291 336 7.96E-05 PLN03224 PLN03224 - NC
multi-dom 234331 234 345 0.000149871 TIGR03724 arch_bud32 - NC
multi-dom 226168 234 345 0.000289722 COG3642 COG3642 - NC
multi-dom 215061 246 403 0.000386873 PLN00113 PLN00113 - N
multi-dom 165478 297 392 0.000486608 PHA03212 PHA03212 - NC
multi-dom 165291 228 437 0.000556281 PHA02988 PHA02988 - N
multi-dom 223733 216 348 0.00289805 COG0661 AarF - NC
multi-dom 165211 273 340 0.00363433 PHA02882 PHA02882 - NC
Conserved sites/feature
Type Brief name Coordinates Complete size Mapped size Source domain
generic active site V250,M266,E267,L268,C269,E273,L275,D313,K315,E317,N318,L320,D334,L337,G352,S353,A354,Y355 26 18 173660
generic ATP binding site V250,M266,E267,L268,C269,E273,D313,K315,E317,N318,L320,D334 20 12 173660
generic substrate binding site E273,L275,D313,K315,E317,L337,G352,S353,A354,Y355 11 10 173660
generic activation loop (A-loop) I333,D334,F335,G336,L337,S338,G352,S353,A354,Y355 11 10 173660
 
DNA sequence
Upstream 1000 bp region from PH01000068G0320 gene.
AAGTTCGTGAGAGTGAGACATGGCCACAAATTCTCACCCCTATACATTTCTGTAAACAGCAGGACAGTAGATTTCTTTTAGTATGTTTTTTGTTTGAAAATGCAGTAAAGACGTAAACTTTAGATACATTTGTATATGTTTTTGTTTTTCATGAAATAATGAAGATTTTCCATTGGTTTTAAAAAATGAAGATTTTCCCTTAGTGTTATTGCGCCAAGTAGAAATTTTTTTATTAATTAACCATTTTTTAATTTTATTTGAAAGTTAATCTTCGGCGAACTTTATTTCTAATTCTGACCCCCTTTGATCACGCCACCACATGTGGCGTGATAAAATAATACTGTCACGCCAGCCCATATCCGGGAGAGCTCTTATCTTGCCACCACCCATGACGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTAACTTTAAAATAAAAATTTAAAAAAAGTTAAATGTTAATTAATAAAAAAAGTTCCGCCAAGTATCGATCGAATGGCTAGCATTGCGCGTTTGAATTCTTCTATTTCAAGACAGGTTCATTCTAGGAGTGACCCACCTGGCCACCTGGTCTAAAGAGCCTCCATTTAGATGATTAATGATTTAGTAAGTTGTCACAAAGAAAGCTGTATATTGTGACAGTGATGAGTGAGTGATGACCAACAAATAGAAGGCAACAAAAACAGGAACAAAAGAAATTGCCACCCATGCAGTATGCCGCCCCAACCCCACTCCCCATTCCCCTCCTCAACCAAGCACAGCACACACAGTCACACACTGACACACACGCAGACGCAGGGAGGGAGGGCTAGAAAAGAAAAGAAAAAGGCAGAGGACCAAAAAGAAAAA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGGGTCTCTGCCACGGCAAGCCCACGCAAATCCCGGAGCCCGAGGCGGAGGAGGAGCCCCATGTAGCCTCCAGCGCCGGCGATGCCGTCGGAGCCGCGAACGGCGTCTCCTCGCCGGCGGCCGCGGCGAAGCTGGGCACGCCGAAGCAGCCCAACGTGGCGTCGACGCCGGCGCGCGGCGGGTTCAAGCGGCCGTTCCCGCCGCCGTCGCCGGCGAAGCACATCCGCGCGCTCCTGGCGCGGCGGCATGGCTCGGTGAAGCCCAACGAAGCGTCCATCCCCGAGGGTGGCGAGCCGGAGCTGGGCCTGGACAAGAGCTTCGGCTTCTCGAAGCATTTCTTCGCCAAGTACGAGCTCGGCGAGGAGGTCGGCCGCGGCCACTTCGGTTACACCTGCGCCGCCAAGGCCAAGAAGGGCGAGCACAAGGGCGAGGACGTCGCCGTCAAGGTCATCCCCAAGGCCAAGCACGCTAAGATCGAAGAAAAGGAGGCACCTTTACCCGCACTTCGTTTTCTTTTAGCTCCCGGGGTGCCCGTGATTGTTGGTGGGAGGGTGACCTCGCCGCGCCGGCAGATCACTTGTCTGCTTGTTACCTGTTTAGTGCAAACTGTGCAAATACATATTTATTCAAGCTGCTGTCTAGTCTCACCCAATGAAGTCTGTGGGCAGATGACGACTGCTATAGCCATTGAAGATGTCAGAAGAGAAGTGAGAATATTGAGTTCTCTGACAGGCCACAGCAACCTAGTGCAGTTCTATGATGCTTTTGAAGATGAAGATAATGTGTATGTAGTTATGGAATTATGTAAAGGAAGTGAACTACTGGATAGGATACTGGCGAGAGGTGGAAAGTATTCTGAAGAGGATGCAAAGGTTGTTATGGTGCAAATTTTGAGTGTTGTATCATTTTGCCATCTTCAAGGTGTTGTTCATCGGGATCTGAAACCGGAGAATTTCCTATTCACATCGAAGGACGAAACCTCTGCCTTGAAGGTCATAGACTTTGGCTTGTCTGACTTTGTAAAGCCAGATGAAAGACTTAATGACATCGTCGGAAGTGCGTATTATGTTGCTCCCGAGGTGCTTCATCGATCTTATGGCACCGAGGCAGATATGTGGAGCATTGGAGTAATTGCCTACATTTTGCTTTGTGGGAGCCGGCCTTTCTGGGCGCGCACTGAGTCAGGAATATTCCGTGCTGTCTTGAAGGCAGAACCAAGTTTTGATGAGGCCCCATGGCCTACTCTCACTGCTGAAGCTAAAGACTTTGTAAAAAGGCTGCTTAATAAGGATTACCGCAAGAGGATGACTGCTGCACAAGCTCTCAGTCATCCATGGATCCGTAATGCTCAACAAGTGAAGATTCCTTTAGATATGATAATCTACAAGCTTATGAGAGCTTACATCAGTTCATCTTCATTGCGAAAGTCTGCTTTGAGGGCCTTGGTGAAGAATTCTACGGATGCAATGAAGGATGCTAGGGTTGTTGACTTTGTGAACACGGTGTGCACTCTTCAGTACAGAAAATTGGATTTTGAAGAGTTTGCTGCTTCTGCCATCAGCGTTTATCAGATGGAAGCTTTGGAGACCTGGGAACAGCACGCTCGGCGTGCATACGAACTATTTGATAAGGAAGGCAACCGGCCTATTGTAATCGAAGAACTTGCATCGGAACTTGGACTTGGCCCATCAGTCCCTCTTCATGTTGTTCTCCAAGACTGGATCAGACACGCCGACGGAAAGCTCAGTTTCCTCGGATTCATAAAACTTTTGCATGGAGTTTCTTCCCGATCGATCCCGAAAGCCTAA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01000068G0320 gene.
AAAAAAGTTCCTGCTTATGACTACTGCGTCTACCCCTCCCCTTGCCAAGTCCATTGATGTTGTACTGAAGCTGTGTAGACGAATGTACAGATGAGGATAGGAAAAGAATATGGAAGGGCTCAAGATTTGAGACTGCTGTTTGTCAATGTCTGCATTGTAGTGCTCCTTTTGTCTCAAACAAGACATTAACGTCTCACCTTACTACCCCCTTGTGTTAAGTCACATCCCTGATTGCAGATTGCACTGTGTATTATTCATCTCTTTGTACTTCTTGCAATAGCTTCTCTGCAGCTTTGTAGCATGCGATATCTCAGAGTTGCCCAGTCCATTGATGATGGGAGATAAACATTTTCCAGCAAGGCTGGCGCTGCTACTATCCAAGCAGCCACATAAACCTACATATGCGTATTTGCATGCTATTGACACAGCAGAATTCAGAATCAAGGGAATTACTTTTGCAGTGTTGCAGCCTTCTTGAACAGTAACACAGCTCGGAACCCATTGATTGAGCTGTTACTACTCATCCAATGCAGTATTGTGATGTTCTCTCTTTATCGCGCTCTGTTCATAGCAAAAGCGCATCACAATTCACTGTGGCGTTGCTGCTCTTGGTGTACACGTACAACGCTGTCAATGCTGCGTTGTCGCTATCGTGCAAGGAAAAGAAAGCAAAAGCGCTGGGCCTGGACGGCCGTACGGCAAAGCAAGTCCGGCCAAGTTCGATGCCGAGTCCGGCCGGAGGGGGCCCACTGACAGAGTGAGAACGGTAAGAGGACCAGAGAGATCCATCCAACCTCTCTGAACTTATCACGGTCAAAACAGCCGTCACCTCTGGGGGCATCTACTCAAGTCATTTTACAAAACAAGTACGAAATCCCATCGCATGAGTGGCTCCATTTTGGCTGAGTCGTTCAAGGGAGGTTTGCTTGTCTCCTGGTTGACGTTTGTACGTGTCTCTTCGTACGCGAAAACAACTTATTTGTGTGCGAGTTTATATGCAA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01000068 Download
Protein sequence
Protein sequence
MGLCHGKPTQIPEPEAEEEPHVASSAGDAVGAANGVSSPAAAAKLGTPKQPNVASTPARGGFKRPFPPPSPAKHIRALLARRHGSVKPNEASIPEGGEPELGLDKSFGFSKHFFAKYELGEEVGRGHFGYTCAAKAKKGEHKGEDVAVKVIPKAKHAKIEEKEAPLPALRFLLAPGVPVIVGGRVTSPRRQITCLLVTCLVQTVQIHIYSSCCLVSPNEVCGQMTTAIAIEDVRREVRILSSLTGHSNLVQFYDAFEDEDNVYVVMELCKGSELLDRILARGGKYSEEDAKVVMVQILSVVSFCHLQGVVHRDLKPENFLFTSKDETSALKVIDFGLSDFVKPDERLNDIVGSAYYVAPEVLHRSYGTEADMWSIGVIAYILLCGSRPFWARTESGIFRAVLKAEPSFDEAPWPTLTAEAKDFVKRLLNKDYRKRMTAAQALSHPWIRNAQQVKIPLDMIIYKLMRAYISSSSLRKSALRALVKNSTDAMKDARVVDFVNTVCTLQYRKLDFEEFAASAISVYQMEALETWEQHARRAYELFDKEGNRPIVIEELASELGLGPSVPLHVVLQDWIRHADGKLSFLGFIKLLHGVSSRSIPKA
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above