gene PH01000046G1660
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01000046:1198045 - 1207736(- stand)   Name
Alternate name Locus tag PH01000046G1660
Length of gene 9692  bp Length of CDS 3162  bp
Product information
Feature type
CDS
Product name
suppressor of phythchrome A
Alternate name
Molecular weight
(predicted)
116827.06332  kDa
Isoeletric point
(predicted)
6.09618759155273
Length
1053  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
(0 result)
SNP ID Position Base in Scaffold Polymorphism
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_143093 4
Please click OG5_143093 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
(0 result)
Gene ID Short description Curator summary Computational description E-value
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os05g49590.2 suppressor of phythchrome A, putative, expressed 0
 
Function (determined by interpro in EMBL-EBI)
Protein family membership

None predicted.

Domains and repeats
  1. Domain
  2. Repeat
1 100 200 300 400 500 600 700 800 900 1000 1053
Detailed signature matches
    1. SSF56112 (Protein k...)
    1. SSF50978 (WD40 repe...)
    2. PS50294 (WD_REPEATS...)
    1. PS50082 (WD_REPEATS_2)
    2. SM00320 (WD40)
    3. PF00400 (WD40)
    1. PS00678 (WD_REPEATS_1)
Unintegrated signatures no IPR
Unintegrated signatures
  1. PTHR22847 (WD40 REP...)
GO term prediction

Biological Process

None predicted.

Molecular Function

GO:0005515 protein binding
GO:0016772 transferase activity, transferring phosphorus-containing groups

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
non-specific 238121 801 989 9.66E-22 cd00200 WD40 cl02567 N
superfamily 243092 801 989 9.66E-22 cl02567 WD40 superfamily - N
non-specific 238121 853 1052 4.67E-21 cd00200 WD40 cl02567 C
non-specific 238121 801 1049 5.27E-19 cd00200 WD40 cl02567 -
non-specific 238121 801 965 1.13E-17 cd00200 WD40 cl02567 N
non-specific 238121 932 1047 2.13E-07 cd00200 WD40 cl02567 C
non-specific 201208 933 965 0.000399503 pfam00400 WD40 cl02567 -
non-specific 197651 927 965 0.000630786 smart00320 WD40 cl02567 -
multi-dom 177776 521 1053 4.80E-101 PLN00181 PLN00181 - N
multi-dom 225201 805 1049 2.40E-15 COG2319 COG2319 - C
multi-dom 225201 798 989 2.59E-15 COG2319 COG2319 - NC
multi-dom 225201 795 967 5.21E-12 COG2319 COG2319 - N
multi-dom 177776 331 429 1.12E-09 PLN00181 PLN00181 - C
multi-dom 225201 799 984 1.38E-09 COG2319 COG2319 - N
Conserved sites/feature
Type Brief name Coordinates Complete size Mapped size Source domain
generic structural tetrad H801,A820,S825,F831,E832,K853,A870,D875,W881,D882,E894,H895,F912,D916,Y922,D923,G936,H937,I953,D958,W964,D965,G985,H986 40 24 238121
 
DNA sequence
Upstream 1000 bp region from PH01000046G1660 gene.
CAGTAGGAAATCAACTCTTCAAATCAGCGAAATCCTCCCAAGTAGCCGCGGCCGGCGACACTCCAGACCATTGGACTAACACCTGAGTCCCCGATGCCGATCCAGATCTTTGCAAACGACTGCCCAATATCTTTTCCGGCATTCCGACAGCTACATCATCAGGTATATCTTGCTGCACCTTCTCATTCGGAGCGAGAGCTTTTTCAATTGCGAAACATGAATCACTGGGTGTATCTTACAGGTCTACGGCAACTTCAATTTGTATGCCACTGAACCCACTGATTGCTCAATCTGAAAAGGCCCAAAGTACCTGAACGCCAGTTTATGGTGAGCTCGGTTTGCCACTGAAGTCTAAATATAAGGTTATAACTTCAGATAAACCCAATCCCCCACTGTGAAACTACGCTCTGATCTTTTTCTATCGGCTTGGATCTTCATACGTTGAGTAGCCCGATGAAGATGTTGGCGCAATAGTTTGGTCATCAGTTCCCTGTCTAGTAACCAGACAGATAATTCCGGGGAAGTACAATCCGAAGCATCCACCAGACCAAAGTGGCGTGGGCTATGACCATATAAAACCTCAAAGGGTGACTTTTGTAGAATGGAATGAAGTATTGTACCAAAACTCAGTGAAGGCCAACCATTCTGACCATTCACAGGGACAAGCATGCACAAAAACATCTCAAATACGCTTCAAGGCATTGATTAACCCGCTCCGTCTGACCGTCGGTTTGTGGGTAGTAAGATGAGCTCATCCTCAATTGGGTCTGCACTAACCGAAACAATTCTCTCCACAGTGTACTGGTAAAGATGCGATTTCTATCTTATACCAAGGATTGAGGCCGGCCATGAAGTTTGAAAACATTGCTGATATAAACGGACTTGCAAAAACAGGAAAACGGAAAAGGAAAACGGAAAGAGAGGAAGATTTTCCGAATTGAGAATGAAATTAAAAAAACAGGCCGGAAATCTAAAAACTTTTGAAATTACCAAATTTTGGG
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGGAAGGGACGACGGCGGCTGAGGTGGCCGGTGCCGGCGGCACGGCCGGCGAGGTGCAGATTAAGGGCAGCAAGGAGAATGGGCAGCCCGCGCAGCAGCCGTCCGGCAGCGAGGCGCTGGAGATGCCCACCACGCCGCTCCCGCTCCCGCGGGACATAGATTGGTCCGAGCATTTCTCCTTCTTCAATTCGTTGGGCGGGTTTGCAGGCAGCACAGATGGTGCCAGGGGATTGACTAGTGCTGGCCTGTCGAATTCTGAGTCTAGGCCAGACACTGTGACCCAGCGTTGTTTGAATAATGCAGACGAGAGGGTGGAGGAGCTCACGTTGAAGAATTGCATCAACACTGATGTTCAACCTGAAGTTTCTGCTGGTGGAAGCTCAAGCAGCGGGGAGAAGCCTACTGTTATGAGGGGCCTGTGGGGTAATTTTGCGCGGATGGCATGGAGAACTGGTGATGTGGCCAGCAGGGAAAACTTAGCAGTGAGTCGTGGCGACATTGCAAACTTGAGGACTGGTGATGTGGGCCATGTTGCTAGCAGGGAAAATCTGGCAGTAAGCCTTGGAAACAATATGATCTCACGGAACAATGATGCATCTAGCAAGGAAATGGCAGTGAGCCGTGGCATCGATGTGAATGATGAGTTCAACCTGCCATTTGGTAATCAGCAGTCTCTCCTGTCTTCATGGCCTAATCAGAGTGAGCAGCGAGCTGAAAGGGAGAATGCTCTCAAAGTGAGTAGTTTTTCGAATAGAATTCTTGATCAGATGAGAAGTAAGGCTGCAACACCTTCATCTGGGGTTCAGGGATTCCCATTCAAGACTGTATTGAAGGGTAAAGGGGTTGCCTACCAAGGTGCACGGGATATCCAAGTTCAAGCTAACGCAAGGCCCAAAATCCCTATGGATAAGATTCCTAACTCACCATACGATTCTATGGCCAGAGTGGATGGTATGTTTATGAATAGTGGTGGAAATGTTTTAGAAACTCAGTGTGAGGGAACGAGCCTGAGGGAACTAATTAAGCCTGTGCGCCAAACAATGAGCAAGTTTGAGAAAATGCATTTATTTAAGCAGATCCTTGATCTCGTAGACAAATCTCATGCACAGGGTTTTACCTTGCAGCATTTGCGCCCATCATATTTTACAATCTCATCTTCAAACCAAGTAAAATATATTGGTTCTTATACTACACAAGATTTATCAGCTCCGGCCAAACCGGATATCGCCACAGATGATATTTTCAATAGAAAAAGATGCTTTGATCAGAAAGTTGAGCACCAAGAGTTTAATGGAAATGGCAATTCAATCCTAAAGTATCAAAAGGTTGGCGAGCAAGGCTCCATTGCTGTCAGGCGGCCCATACATACCTTTCGGGCTGACCACAGAGGGGGCAACCAAAGCGAAGACATTGATCCAGGTGCTTCATGGCAGGGAAATTCTAGTTGCACTGCCAGAGAACGTTTTAAGTTTGGTGAACCGTACTATGGCAGTAATACATCTTATGCCCAACATCTATCTAATTCTGGCAACCAACAATCAGTGTTTGAATTGAGAATGCTGGAGGAAAGCTGGTACAGAAGTCCAGAAGAGCTCAATCAATTGAAAGGTGTATTCCCATCAAACATCTACAGCCTTGGGGTTCTTCTATTTGAGATTCTGTCTTCAGCCTGGCTGGTAAGCTCTTTTGCTGTTGTGAGACATGGGAGGTGCATTGTGCTGCAATGTCAGATCTTCGCCATCGGATTCTGCCTCCAAATTTTCTCTCAGAAAGTCCTAAGGAGGCTGGTTTCTGTCTTTGGTTACTGCATCCAGATCCTTGTTCTCGACCAAAGGCAAGATCAGACACCGGTTGCTGTCAATGAAGAAGACACAGAATCTGGTTTGCTGCTGAATTTCCTTTCTCAACTGAAAGAAGAAAAGGAGATGCAGGCTGCCAAGTTATCAGCAGATCTTGCAAGCTTACAAACAGATGTCGCAGAGGTTGAGAGAAGACACTCAATGAGGATGGGATTTAGTTTAGAGGACAAGGATGTACTGGCAGGTTCTAATGATTTGACAGGAGCTTCTGCAAATGCCCCAAGAAGTGCATCGTTGTCAGGTTTGCTACCATCATTGTGCAGGTCAAGCATATATGAGGAGAGGGCGATGAGGAATTTGGAGCAGCTTGAAAATGCATATTACTCCATGAGGTCGACCGTTGACACTTCTGAGACTATTGTTACCAAACGTTCGGATAATGATGCTTTGCGGGTCCGTGAAAACTTTTACCAACTTCACAGTGATGCCGATGCTATGAATGAGCAAACAGACCGTCTTGGATGCTTTTTTGATGGTTTATGCAAATATGCCCGGCATAGTAGGTTTGAAGTACGAGGAATTTTGAAGAATGCAGATATACATAACTCTCCAAATGTGATTTGTTCTTTGAGTTTTGACCGGGATGAAGAATATTTTGCTGCTGCTGGGGTTTCAAAGAAAATTAAAATATTCGAATTTGATGCTCTTTTAAATGATCGTGTTGATATTCATTATCCATTGATAGAGATGCCTAGCAAGTCCAAGCTTAGTTGTGTCTGTTGGAACAGCTACATAAAGAACTACTTAGCATCAACAGACTATGATGGCACTGTTCAGTTATGGGATGCAAGCTGTGGTCAAGGATTTACACGGTTTACAGAGCACCAGAAAAGAGCTTGGTCTTTCTCCCCATACTCCTCTCGTATGCTAGCTTTTGGCACAGCTGATTACAAGATATACTGTTATGATCTGAGGAATACAAGAATCCCTTGGTGTACTATTTCTGGACATGGGAAAGCTGTCAGCTACGTAAGATTCTTGGATCCAGAAACACTTATCTCTGCATCAACTGACAACACCTTGAAGATATGGGATCTGAACCGGACTAATTCCAGTGGATTATCTACTAGTGCTTGCAGTCTGACATTGAGTGGCCATACCAATGAGAAGGTATTTTCTTATTACAAGACCTTTCCCATGCCAATAACTTCTCATAAGTTTGGTTCCATCAACCCCATAACTGGACAAGAAACAAATGATGATAATCAGCAGTTTGTGTCGAGTGTTTGCTGGAGAGGGAGGTCAAACATGGTAGTGGCGGCCAACTCTAGTGGCAGCATTGAAGTGCTCGAGCTCGTGTGA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01000046G1660 gene.
GAGTCCTCATAGCCATGGAAATATTGTTTTATAATCTTGTCCTACGGGAACAAAAGGAGATTATAATTAGAGGGGGTATTTTGTTGAGAGAAAAAGAAACACGGAGTATGTATAAAACTGTGGTGGGTCACCAACCAGCCAACTCCATGTACGGCTCCACAGTCCACAAGCAAAGCAAGGCAAAAACTCCCGAGTCACTGACCGGTGAGCCCGTAGGCCCAGCTGCCGGTGTAATGCACAATGCCTAAAATAGCTCGCTAGTAAACGTACAACAACAGGATCCGTATGGTTTTGATCTAGTACCAAAGTTGAACCTACAATGGCCTCACTTCTTAATCCTCATCCTTATCTTCAGAGTTTTCTTTTCTCAAAGAAAGGCAGCATACACATAGTTGAGATTTTAACAAGGCAGGCCTCAAGGCCTGTCACTCTTCCACGACAGCATCTTTATCTTGGTGCTAACTGTTTGTGTGTGTTAAAATTCAGTTTCTATCAACCAAACGTGCCTCTATGATATATAGCATCCTCAAATTTTCGTCAGCATGAACTGTAATATCTCATCTCTGTTAGAGATATGTTAAAGATAGCAATATCTTTTGTATTCTTTATCTGTATTTTATATCGCCTTATCTGTATATAACATATATCTCTTATACACTATACATATATTGCTCGTTAGCCTCTGAATACATGCGCAACCACCTCAACCTTACAGTCCTCCTTGCCTGCCTCGATCGGCCGCGCCGGTCGGTTGACGTGCGGAGGGGAGAAACGGCGTGGTTGCTGGCGCAGGGTCGCGCCGCGCGGCGCGCTAGCTCGTGCGCTCGCGCTCCGGTGCCGCGCGCGACGTGGTGCGCTCCTCGCCACGACCCGCGGCTTTAAACTAGTCCAGCTCGCCACCCTGCGCGATCTTGATTCGTATGGGAGCAGTTGTGAGGCCAGGAACCGCGGCCCCGGATTTTATTATTCTCGTACTGGTCCAAGTCCAAGGTGGCGGGCGG
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01000046 Download
Protein sequence
Protein sequence
MEGTTAAEVAGAGGTAGEVQIKGSKENGQPAQQPSGSEALEMPTTPLPLPRDIDWSEHFSFFNSLGGFAGSTDGARGLTSAGLSNSESRPDTVTQRCLNNADERVEELTLKNCINTDVQPEVSAGGSSSSGEKPTVMRGLWGNFARMAWRTGDVASRENLAVSRGDIANLRTGDVGHVASRENLAVSLGNNMISRNNDASSKEMAVSRGIDVNDEFNLPFGNQQSLLSSWPNQSEQRAERENALKVSSFSNRILDQMRSKAATPSSGVQGFPFKTVLKGKGVAYQGARDIQVQANARPKIPMDKIPNSPYDSMARVDGMFMNSGGNVLETQCEGTSLRELIKPVRQTMSKFEKMHLFKQILDLVDKSHAQGFTLQHLRPSYFTISSSNQVKYIGSYTTQDLSAPAKPDIATDDIFNRKRCFDQKVEHQEFNGNGNSILKYQKVGEQGSIAVRRPIHTFRADHRGGNQSEDIDPGASWQGNSSCTARERFKFGEPYYGSNTSYAQHLSNSGNQQSVFELRMLEESWYRSPEELNQLKGVFPSNIYSLGVLLFEILSSAWLVSSFAVVRHGRCIVLQCQIFAIGFCLQIFSQKVLRRLVSVFGYCIQILVLDQRQDQTPVAVNEEDTESGLLLNFLSQLKEEKEMQAAKLSADLASLQTDVAEVERRHSMRMGFSLEDKDVLAGSNDLTGASANAPRSASLSGLLPSLCRSSIYEERAMRNLEQLENAYYSMRSTVDTSETIVTKRSDNDALRVRENFYQLHSDADAMNEQTDRLGCFFDGLCKYARHSRFEVRGILKNADIHNSPNVICSLSFDRDEEYFAAAGVSKKIKIFEFDALLNDRVDIHYPLIEMPSKSKLSCVCWNSYIKNYLASTDYDGTVQLWDASCGQGFTRFTEHQKRAWSFSPYSSRMLAFGTADYKIYCYDLRNTRIPWCTISGHGKAVSYVRFLDPETLISASTDNTLKIWDLNRTNSSGLSTSACSLTLSGHTNEKVFSYYKTFPMPITSHKFGSINPITGQETNDDNQQFVSSVCWRGRSNMVVAANSSGSIEVLELV
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above