gene PH01000044G0540
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01000044:419467 - 424036(+ stand)   Name
Alternate name Locus tag PH01000044G0540
Length of gene 4570  bp Length of CDS 1320  bp
Product information
Feature type
CDS
Product name
auxin response factor
Alternate name
Molecular weight
(predicted)
47453.5483200001  kDa
Isoeletric point
(predicted)
5.87375259399414
Length
439  aa
Expression profiles
Expression status (Yes/No)
No
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
(0 result)
SNP ID Position Base in Scaffold Polymorphism
Ortholog Groups (determined by OrthoMCL algorithm)
(0 result)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
Comparative genomics
Best arabidopsis hit
(using TAIR10)
(0 result)
Gene ID Short description Curator summary Computational description E-value
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os04g59430.1 auxin response factor, putative, expressed 2E-128
 
Function (determined by interpro in EMBL-EBI)
Protein family membership

None predicted.

Domains and repeats
  1. Domain
1 50 100 150 200 250 300 350 400 439
Detailed signature matches
    1. SSF101936 (DNA-bind...)
    1. PF06507 (Auxin_resp)
Unintegrated signatures no IPR
Unintegrated signatures
  1. PTHR31384 (FAMILY N...)
GO term prediction

Biological Process

GO:0006355 regulation of transcription, DNA-dependent
GO:0009725 response to hormone stimulus

Molecular Function

GO:0003677 DNA binding

Cellular Component

GO:0005634 nucleus

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
specific 197383 30 125 1.72E-18 cd10017 B3_DNA cl15242 -
superfamily 246903 30 125 1.72E-18 cl15242 BfiI_C_EcoRII_N_B3 superfamily - -
non-specific 216995 30 126 8.75E-27 pfam02362 B3 cl15242 -
non-specific 214977 30 126 1.29E-19 smart01019 B3 cl15242 -
non-specific 191545 154 232 2.73E-15 pfam06507 Auxin_resp cl05824 -
superfamily 191545 154 232 2.73E-15 cl05824 Auxin_resp superfamily - -
non-specific 197381 36 121 6.39E-05 cd10015 BfiI_C_EcoRII_N_B3 cl15242 -
Conserved sites/feature
Type Brief name Coordinates Complete size Mapped size Source domain
specific putative DNA binding site S30,G38,S41,P43,R78,L89,T91,T92,W94,S95 11 10 197383
 
DNA sequence
Upstream 1000 bp region from PH01000044G0540 gene.
TTTTATATAGTATCATATTGTTGGTGCACTTAGTAAAGACTAGTTGATTTAGGGTTTAATTGTGCAAAATTGAATTGATTTACAATTCCGTATAAAACTTGGTTTTAGCCAAACAAGTTTTTAAAACCGCCTATTCACCCCCCCTCTAGTCGACCTCCTCGATGTTACAGCAGGCTAACAAACCAAAGACGGTACACGCGTTCCTTTAGGGAATTAGAAATACATAGGACATGTCGACAAATAGTGTCGAACTAGTGCGTGAAATGTGGTCATTTGCCCTTGCGGCCTAGCTCGGCGTTGTACTCCTGGCCTTGCGTCTTAGCTCTCGCCGCGATGGCCCTCTTCCGCTCCCTCCCGGCCTCGTGTCGCCTGGCATGCTCGCGCTCCTTCTCCTCGCACAGCCTCTCCCGCCTCTTCTTCTCCTCCATCTTAGCCTGCAGCTCTTCGAGACGCCTTTCACGGCCATCGTAGTCCTCCCTGGCCCAGCTCTTCTGTGTCAACAGCATTCACGTGTCGTAGGGGTGGATGTTGTCGTCAATCCACTAGCTGAAGTCGCATAGGCGTGATGGAGACTGTGGTGGGAAGAGATACATGGTTACAGCGTAACGAGAAGCAAAAAAATGGTGTGCACTTGAATACGATTTTTTTTATCTTTATTTTTACTTAATCTCTCAAAATACGGATATAACGAGTTCGCGATATTGCCGTGTATATATGTGTGTACGTGGAGCGTCGAAGTGGAGACGACGGGTAGATGTAGAGGCAGGACATGCAGGCAGCAGGCACAGGATTAATGTATCCTGTCCACTTTATTTTGCTTTGTGAGAAGGGAAGCAAAACGTGTCGTCCACTAGCTCTCGGTTGGAGGTTTATTTCCGTACGTGTCGTGTCAATCTCCCTCTTGGAATTGGATTCATCTCAATCTCATCTATTAGTCACGGGTACGCGCCCGTCCCGCTTAAAACGCAGCTAATTACGTACGGCTAAGAAGTAATAATAAA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGGCGCAGCCCCCCGCCGCACCGCTGCTCGACCCCCTCGTCTGGCTCGCCTGCGCCGTCCCGTTCTCCCGCCTCCCCGCCGTCGGCTCCCAGAGCGACGCCAACAACGGCGGCGGCTTCTCCATCCCCAGGTTCTGCGCCGACTACATCTTCCCCAAGCTCGACTTCGAGGCCGACCCGCCCGTCCAGAAGCTCCTCATGCGGGACCTGCAGGGCAAGGCCTGGGAGTTCCGCCACATCTACCGCGGCACGCCGCGCCGCCACCTCCTCACCACCGGCTGGAGCAAGTTCGTCAACGCAAAGCTGCTCGTCGCCGGCGACACCGTCGTCTTCATGCGCCGTCCCGACGGCGAGCTGCTCGTCGGGGTGCGACGCGCGCCCAGGTACCCCGTCTCGCTGCACGCCGCCGGCCCGCTCCGCAACGCGCGGGCGCGTGTCCCGCCCCAGGAGGTGCTGGACGCGGCGCGGCTCGCGGCGGAGGGGAGCACGTTCACGGTCACCTACTACCCGAGGCAGGGCGCGGGGGAGTTCGTCGTGCCGCGCAAGGAGGTGGAGGGCGCGATCAACAAGGGAGACTGGGAGCCCGGGGTGCAGGTGCGCATGCAAGTCATGGAGACCGAGGACTCGCGCCGCTCCGACTGGGCCAACGGCACCGTCAAGGCCGTCGATCCCTCCACCATCTGGCGCATGCTCGAGATAGACTGGAATGACTCCACGTCATCGTCTTCAGCAAAAAGCAGGCATGTTAATGCTTGGCAAGTCCAACTTGCTGGATACCCTCCTCTTCTGAAGAGGCTTAGGATTTCTGAAGCCATTCCACCTGTGTGCTCTGGAACTGGCGCCATTGCTGACCCATTGATGGGACCAGAAAGTCAGAACATGGCTATACTACTGGGCTCACCAATTCCTGCGGGCATGCAGGGAGCCAGGCATAATGCCCCTACTGATGTACCCTCTTCATCCGCTAAAATGTTTACAACTCAGCTACTGTTCCCCGGGGATCTTCAGATTCCACCACCCAGCCTGAGTGGTGGCTCCTCTGAGATTGTGAATCCTGAAAATGAATCTCCACCCAACAACTCAGTGAACAAGCATCCATCTGACCTTCCTGACGAAGTGAGGAGCATGCAGCTGTTTGGCACCACAATCACATCACCTGTGCAAAGTGCCACCAATGGTGCTTCTGAAGAAGTGAACCAAGTTCCTAGTGGTGTGGTTGATGGAACTGCTAATGAAGATGCTTCTGCCTCAAGCCCAGTTGACTGGAGTCTCAGTAAAGATGATGGCCACAACCAAAATGATTCTAGGCAACGAGCCTGA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01000044G0540 gene.
ATAAATTAAAAGCAAAAGCAAAGCCTAGATGCAATGTACTACATGTTATTGGTCACTTGTTTACTGACTGCTTGTTTGCTGTGCTTTTCCAGATGGTTTGATCAGATCTGTCTCACCATTTTGACGTGATCTGCTCCACCCCTCTGCGGTTTGATGCATGCAAGTTATCCGGGGTTTTAGTAGGCCTGGTGATCCATCCACCCCCAGCGCAGCGCAGCGCCGCGCCCCGCCCTAGTTGACTTGTTTCGAGTAGTAGTTGTTATCCAGAGAAGCAGGGGATTTGATTCAACCCTTGGTGCTTTGTTAGAGAGGAGCAGCACTTGTCTGTTTCCTTTAGTTTTTCCCATCTGCACATCACATGCATAGTCTCTTAGACTGATGTTGATGCTGGACTGCTCTCTTCCTTGGGTAACTATTATTATTATTATTATTATTATTATTATTTTCTAGTTTTCAAAAAGACAAAAAAAATCTGAAGTCTGCGGCAGCCTTTCCATGCCGTTCTAGCATTTCCTTTTCCAGTTGGTGGCGTGGGTTGACAAAGCCCCGTACTGTCTTCGTGGAATCATGCTTCGGGGTTTATTTGGATACATTGTGATCCGACTCAATTCTTTCGGATTGACTCCGAATTTAAACTAAAATCTTTTCTAATCCAAAGTAATTTGTTATAATATCTCCCTATCCAAACAAGCCCTCAATTGGCTTGATGATCCATACTAGCATCTGATGAACTTTTCTATGCTGTTGCGGGTGTGTTCATTGGTCCATCGAAACGATGGTGTTGGGAATTACTAGTGTGTGGTGTGGATTGGATGAGAAGAGATGCGTGCAGCGCACTGATGATCAGCCCGAGGCCCGTCCAAACGAGCAGTCCATTTTTGTTGGAAAGCAAGAGGTCATCTCGCCAAAGTTGAAAGAGATGCCATACGATAATTAATTGGTACCAGTAGTATGTGCAGATGGAATGGCGTCACACGATGATCAGTGTACATTAATTATAT
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01000044 Download
Protein sequence
Protein sequence
MAQPPAAPLLDPLVWLACAVPFSRLPAVGSQSDANNGGGFSIPRFCADYIFPKLDFEADPPVQKLLMRDLQGKAWEFRHIYRGTPRRHLLTTGWSKFVNAKLLVAGDTVVFMRRPDGELLVGVRRAPRYPVSLHAAGPLRNARARVPPQEVLDAARLAAEGSTFTVTYYPRQGAGEFVVPRKEVEGAINKGDWEPGVQVRMQVMETEDSRRSDWANGTVKAVDPSTIWRMLEIDWNDSTSSSSAKSRHVNAWQVQLAGYPPLLKRLRISEAIPPVCSGTGAIADPLMGPESQNMAILLGSPIPAGMQGARHNAPTDVPSSSAKMFTTQLLFPGDLQIPPPSLSGGSSEIVNPENESPPNNSVNKHPSDLPDEVRSMQLFGTTITSPVQSATNGASEEVNQVPSGVVDGTANEDASASSPVDWSLSKDDGHNQNDSRQRA
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above