gene PH01000040G1590
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01000040:1055964 - 1064657(+ stand)   Name
Alternate name Locus tag PH01000040G1590
Length of gene 8694  bp Length of CDS 2478  bp
Product information
Feature type
CDS
Product name
expressed_protein
Alternate name
Molecular weight
(predicted)
92416.77242  kDa
Isoeletric point
(predicted)
9.65418624877929
Length
825  aa
Expression profiles
Expression status (Yes/No)
No
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
SNP ID Position Base in Scaffold Polymorphism
PH01SNP00382260 PH01000040:1058280 C C_T
PH01SNP00382270 PH01000040:1059740 C C_T
PH01SNP00382280 PH01000040:1059778 C C_T
PH01SNP00382290 PH01000040:1060227 A A_G
PH01SNP00382300 PH01000040:1060553 A A_C
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_128182 2
Please click OG5_128182 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
(0 result)
Gene ID Short description Curator summary Computational description E-value
Best rice hit
(using MSU7)
Gene ID Product description E-value
LOC_Os03g61560.1 expressed protein 0
 
Function (determined by interpro in EMBL-EBI)
Protein family membership

None predicted.

Domains and repeats
  1. Domain
  2. Repeat
1 100 200 300 400 500 600 700 825
Detailed signature matches
    1. SSF48371 (ARM repeat)
    1. SM00025 (Pumilio)
    2. PS50303 (PUM_HD)
Unintegrated signatures no IPR
Unintegrated signatures
  1. PTHR13389 (UNCHARAC...)
GO term prediction

Biological Process

None predicted.

Molecular Function

GO:0003723 RNA binding
GO:0005488 binding

Cellular Component

None predicted.

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
(0 result)
KEGG orthology Functional Subsystem Pathway
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
(0 result)
ID for KEGG orthology Reaction description EC number
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
non-specific 153420 179 346 5.94E-05 cd07920 Pumilio cl02427 C
superfamily 243032 179 346 5.94E-05 cl02427 Pumilio superfamily - C
non-specific 153420 178 266 0.000247242 cd07920 Pumilio cl02427 NC
non-specific 153420 164 264 0.00361165 cd07920 Pumilio cl02427 C
Conserved sites/feature
Type Brief name Coordinates Complete size Mapped size Source domain
generic RNA binding site Q181,V213,F214,K217,A250,D253,Y272,C273,L276,Q306,Y307,T309,T310,Q313,T340,S341,S343,N344 28 18 153420
 
DNA sequence
Upstream 1000 bp region from PH01000040G1590 gene.
GCAAGATCTCAGTGCGCTCCTGTGCTCTGACACCATAGGGCGCAGGGTGAATCCACGGTACGCCCGCTAGAAATAGGAGGATGAGTGTTTTTCACTCTCTGTGCCATATACTTGTATAGTTGTATACCTCCAGGGGAAAATGCTTTTTTTAACTCTTGAAGTTATGTGTCATATACTCATATTTGGTTTTTAGGATCATTAGGGAGATTCAATTATTTACCACTGTCAAATATGCTTAATTAATTATTTATCACTGATGTGATGTTATACTCAAATACAGTGGTAAATTGTAAAATTCACCTTTTTACAGTGGCAAATAATTAAATTTTCTTTTTTTTGGGGTCCCTTGTTACTGAGTCTCAGGAGTTGGATCCACTTGTAAAATGATTTGTGTTTTCCTATTTTCTTTGTCAAAAGATTATGAAATGAGAGTGAATTGTGGATTAGTGATTGATTGTTTCGACTGCTAGTATGGTGAAAGTTGTATGCAGTTTATCCCCTTTATGGTTTAATACTTTAATTTGACGAAACCAACCACCTTTTGTACCTCTCTGGTGTTACAATGTTGCACTACTGAAAAAATACATGGTGTGTTAGTGTCTGTTTGATGTACGTGAACATATCCCTGTTATTCTATTTTTTTCACCCTTCTAGTGGTGCTTCATACATATATTACAGGACATGCAACGGGTAGACGGGTATACCCGCGGGCGACGAGACATGGGTGAGGTTCTTCGCCCGTCGTCCTTCACGGACATACCTGTGAGGGGAAATTGGAGTCATGGGCATAGACAAGTACTACCCGTACCCGCCGCGTCCGATTGCCATCCTATTCCGGCCCCTCGGTCCTAGTAAAACCCTCTATTTCATTTCTGGTTAGTAATCTTCGTGCATATAGTATATCTAGATTTTATATAGAGATTATTTATGCAGGTGTAATATTTATTATAGATTTTAGAGTTTACGTGATATTTCTATAAGATATGTAGAATCTTTTTCGA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGGCCGGCGGCGGACACGACCTCCAGAGCCCGAAGAAGCGGAAGCGCGAGGTGGCGGGGAAGCCCAAGCCGCTGGGGAAGGGGGTTGATGACAGCAAGAAGCGGAAGAGGCCCTCCGACGCCCGCGTGGCGCACGGCGGCGGCGAGGCCAAGGCGAAGAAGCAGCCGGTTACTGCCAAGGAAAAGCGACTGGCTGCCAAGGAAATGGTGGAGTCAAGGAAGAAGAAGCGGAAGCGGAATTACAGCCTTGAGAAGGAACTTACGATACTATGGGAAAAGATGAGATGTCACAATGTGACCAAGGTGGAGAGATCCAAGATAGTAAGTGAGGCTCTCCGTAAAATGAACGGGAAATATTTGGAAATTGCTGGACCCCCTGTAACTGCACGTGTTCTTCAAGAACTTACGATACTATGGGAAAAGATGAGATGTCACAATGTGACCAAGGTGGAGAGATCCAAGATAGTAAGTGAGGCTCTCCGTAAAATGAACGGGAAATATTTGGAAATTGCTGGACCCCCTGTAACTGCACGTGTTCTTCAAACGTGTGTGAAGTGGTGCTCACAGCCTGAGAGGGATGCTATTTTGGATACCCTGCAGCCTCATCTGCTCACCCTTTCTCGCCAGAAATATTCTGTTTTCCTTGTAAAGAAGCTCATAAAGTTTGCCACTAAAAAACAGTTTGCCTGGTTCATCTCTTCTCTTCATGGTCATGTCGCTCCACTTCTTCGTCATACTATAGGAGCTGCAGTTGTTGACTTTGCATTTCAGCGGGCGACACAGCCTCAGAAAAGAAGGTTGTTATTGGAATTGTACTGTACTGAGCTTCAGCTTTTCAAGGACCTGACTGAACAAAATTCCCACAGTTTGTTAGTGGCAATTTCCAAGCTTGGATTACAGAAATCATCTGTCCTGCAGTATATGACTACTGTGCTCCAGCCGCTTTTGGAGAAAGGTATTGTTGAGTATTCCATAGTACACACGGTCATATTGGAATACTTTGCAATTGCTGACAAGACCTCAGCCTCCAACGTGATTCATCAACTAATCCCCCATCTTACTCAAGGATCATCTATCATTGATGGAGATGAACCATCGGTTGCCCCCGAATTACCAAAGAAAACAAAAGCTAAGAAGAAAAGGTTATCAGAACCACTTCTCGTTCGGATCGTGCACACAAGAGAAGGATTAAAAATAGGGATTTGTTGCCTTAAGCATGGCAGTGTAAAGGAAAGGAAGAAGATTATTAAAAGCTTGAAGGGGTACATTATGAAGCTTGCTCTCAATGATTATGGGTGCCTTTTCCTTGTTGGCATTCTTTCCATTGTTGATGACACAAAGCTTGTCACCAAGCGGCTTTTGGAGAAAGGTATTGTTGAGTATTCCATAGTACACACGGTCATATTGGAATACTTTGCAATTGCTGATAAGACCTCAGCCTCCAACGTGATTCATCAACTAATCCCCCATCTTACTCAAGGATCATCTATCATAGATGGAGATGAACCATCGGTTGCCCCTGAATTACCAAAGAAAACAAAAGCTAAGAAGAAAAGGTTATCAGAACCACTTCTCGTTTCGATCGTGCACACAAGAGAAGGATTAAAAATAGGGATTTGTTGCCTTAAGCATGGCAGTGTAAAGGAAAGGAAGAAGATTATTAAAAGCTTGAAGGGGCACATTATGAAGCTTGCTCTCAATGATTATGGGTGCCTTATTGTAATTCAAGAGCTGGCAAAGCAATTAAAGAAACTCATTTTTGACAAGTTCCTTGTTGGCATTCTTTCCATTGTTGATGACACAAAGCTTGTCACCAAGATTGTAATTCAAGAGCTGGCAAAGCAATTAAAGAAACTCATTTTTCACAAGGGTGAGGAATCAGAGAGCGCTATTGAAATTATCTCGGAGAATAAGGGGGATGCTGTGGCTGATAAAGATCACGGTGGTTCAGAAGGCACGCAGATTGCGCCTGACAGCAAGAAGGACCCATCACAGCGGCGACATGAATTGTTGATGAAAAGTGATCTTGCTGAGGCTCTCATCCAGACTTGCATTGAAAATGTTGGGGAGTTACTTCGAACAAATTTCGGCAAAGATGTATTATATCAGATCGCTGTTGGTGGAAAAGATAATATTTTGGAGGGCGTCACTGACAGAATCCATATATTTCACAATGCAATAGCTTCTGATGCAGCGCGTCCAAAGACAGAAGATATTGAGCACACCTTTGAGAACTTCCATTCCAGCCGTGTAATCAGAAGAATGATTCTTGATTGTCCTACATTTGCTGCTACCCTCTGGAAAAAGGCTCTTGAAGGGAAGTGTGAGATATGGGCTGATGGATACAGTTCCAAGGTGGTTGCAGCATTCCTGGAATCTCCGAACTCCAAGGTGAGGGATCTTGCAAAATCCGAGCTGCAGCCGCTGATTGATCGTGGCATTCTGAAAAACCCAGACCATAAAGCAGTGGAGAAATGA
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01000040G1590 gene.
ATAAAAATAATTATTTGGTTTTGTTGAAGTTCTAAAACCTTGACTTGAGATTTTAGAATTAAAGGTGTTTAAAATGATTTAATCAAACTTCAATTAATTCAAGTTTGGTTTATTTTGAGTTTGCTGGGGTTCTCTGATGTTTGAAAATCCCTTTTCTCTGTTCGCCCCGTTCTCTCCTTGGCCTAGCTCACTTCCCTTTTGGTTTAGATATCCCTTTCGGTTTAGACCTTCCCTTTTGGTTTAGACCTCCCTTTCGTTTGGACCTCCCTCTCGTTTGGACTTCCCTTCTCTTTGTCCAGACATCCCTTTCGTTTGGACACCCCCCTCTGTCCAGACCTCCTTCTTGTTTGGACCTCTCCCTCTGTCCAGACATCCTCCTCGTTTGGACCTCCCCTTCTGTCCAGACCACCTTCTCGTTTGGACCTCTCTCTCTGTCCAGACCTCTATCTCGTTTGGACCTCCATTCTCTCTGTTCAGACCTCCCTTTCATTTGGACCTCCTTTGTCCAGACCTCCTTCTCGTTTGGACCTCCCTTTTTATCCAAACCTCCTTCTCGTTTGGACCTCCCCCTCTGTCTAGACCTCCTTCTCGTTTGAACGTCCCTCTCGTTTGGACCTTTTCCCCCAGTCCAAGACCTCCTGGGTGGTCCTGGTCCTGGTCTTGGAGACCGGTCACGACCTCCCCTTTGGGTCATGACCTCCCCTTGGATCACGACCACCCCTTGGGCCATGACCACCCCTCCTTGGTCTCGACCTTTCCTTTGGTTGGACCACCCTTCTGAGTTTTGACTGGCCCCACCTGTCAGCTCTGTTCACTTTCTTCTTCTTCCCGTTGCGTCACTGCTGACACAAAGGTCTTTGAACATTAAATGCTGTTGTGTCGCATTAAATGCTGTCTTTTCTGCAGTACCCGTTTCCCCCTCTTGTCTCCTCCCAGACCTGCTCCCATCTCCTCCTTCACCTACCTTTGATCACGTGTGCTTCAGTCTCTCAGCTGCTCCT
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01000040 Download
Protein sequence
Protein sequence
MAGGGHDLQSPKKRKREVAGKPKPLGKGVDDSKKRKRPSDARVAHGGGEAKAKKQPVTAKEKRLAAKEMVESRKKKRKRNYSLEKELTILWEKMRCHNVTKVERSKIVSEALRKMNGKYLEIAGPPVTARVLQELTILWEKMRCHNVTKVERSKIVSEALRKMNGKYLEIAGPPVTARVLQTCVKWCSQPERDAILDTLQPHLLTLSRQKYSVFLVKKLIKFATKKQFAWFISSLHGHVAPLLRHTIGAAVVDFAFQRATQPQKRRLLLELYCTELQLFKDLTEQNSHSLLVAISKLGLQKSSVLQYMTTVLQPLLEKGIVEYSIVHTVILEYFAIADKTSASNVIHQLIPHLTQGSSIIDGDEPSVAPELPKKTKAKKKRLSEPLLVRIVHTREGLKIGICCLKHGSVKERKKIIKSLKGYIMKLALNDYGCLFLVGILSIVDDTKLVTKRLLEKGIVEYSIVHTVILEYFAIADKTSASNVIHQLIPHLTQGSSIIDGDEPSVAPELPKKTKAKKKRLSEPLLVSIVHTREGLKIGICCLKHGSVKERKKIIKSLKGHIMKLALNDYGCLIVIQELAKQLKKLIFDKFLVGILSIVDDTKLVTKIVIQELAKQLKKLIFHKGEESESAIEIISENKGDAVADKDHGGSEGTQIAPDSKKDPSQRRHELLMKSDLAEALIQTCIENVGELLRTNFGKDVLYQIAVGGKDNILEGVTDRIHIFHNAIASDAARPKTEDIEHTFENFHSSRVIRRMILDCPTFAATLWKKALEGKCEIWADGYSSKVVAAFLESPNSKVRDLAKSELQPLIDRGILKNPDHKAVEK
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above