gene PH01000000G3800
Feature Overview
Species moso bamboo (Phyllostachys edulis) Feature type gene
Genomic location PH01000000:2443489 - 2445437(- stand)   Name
Alternate name Locus tag PH01000000G3800
Length of gene 1949  bp Length of CDS 879  bp
Product information
Feature type
CDS
Product name
heat stress transcription factor B-1
Alternate name
Molecular weight
(predicted)
31219.9937199999  kDa
Isoeletric point
(predicted)
5.06556320190429
Length
292  aa
Expression profiles
Expression status (Yes/No)
Yes
Heterozygous SNPs
As a diploid organism, heterozygous SNPs indicate different nucleotides at two bi-allelic loci on the same chromosome.
SNP ID Position Base in Scaffold Polymorphism
PH01SNP00008470 PH01000000:2444419 C C_T
PH01SNP00008480 PH01000000:2444433 C C_T
PH01SNP00008490 PH01000000:2444503 G G_T
PH01SNP00008500 PH01000000:2444545 G G_T
PH01SNP00008510 PH01000000:2444587 A A_T
PH01SNP00008520 PH01000000:2444629 G G_C
Ortholog Groups (determined by OrthoMCL algorithm)
Group ID from orthomcl DB Counts Members of moso bamboo in this ortholog group
OG5_131798 1
Please click OG5_131798 (Group ID from orthoMCL DB) to find more information of orthologs in other species in this ortholog group, which represented species-specific gene expansion families in most of eukaryotic species.
Comparative genomics
Best arabidopsis hit
(using TAIR10)
(0 result)
Gene ID Short description Curator summary Computational description E-value
Best rice hit
(using MSU7)
(0 result)
Gene ID Product description E-value
 
Function (determined by interpro in EMBL-EBI)
Protein family membership

None predicted.

Domains and repeats
1 50 100 150 200 250 292
Detailed signature matches
    1. SM00415 (HSF)
    2. PS00434 (HSF_DOMAIN)
    3. PF00447 (HSF_DNA-bind)
    4. PR00056 (HSFDOMAIN)
Unintegrated signatures no IPR
Unintegrated signatures
  1. PTHR10015 (HEAT SHO...)
  2. PTHR10015:SF7 (HEAT...)
  3. SSF46785 ("Winged h...)
GO term prediction

Biological Process

GO:0006355 regulation of transcription, DNA-dependent

Molecular Function

GO:0003700 sequence-specific DNA binding transcription factor activity
GO:0043565 sequence-specific DNA binding

Cellular Component

GO:0005634 nucleus

You may use PPI function to find protein-protein interactions network about moso bamboo.
Pathways (All the pathways are obtained from KEGG)
KEGG orthology Functional Subsystem Pathway
Environmental Information Processing Signal transduction Two-component system  
You may use Pathway function to find more information for detail.
Reactions (All the pathways are obtained from KEGG)
ID for KEGG orthology Reaction description EC number
K15859 osomolarity two-component system, response regulator SKN7
Structure features (determined by CDD in NCBI)
Conserved domain models
Type PSSM-ID Start Stop E value Accession Short name Superfamily Incomplete ?
specific 215924 10 101 1.86E-50 pfam00447 HSF_DNA-bind cl12113 -
superfamily 245876 10 101 1.86E-50 cl12113 HSF_DNA-bind superfamily - -
non-specific 214654 7 100 3.75E-46 smart00415 HSF cl12113 -
multi-dom 227497 11 101 1.19E-27 COG5169 HSF1 - C
Conserved sites/feature
(0 result)
Type Brief name Coordinates Complete size Mapped size Source domain
 
DNA sequence
Upstream 1000 bp region from PH01000000G3800 gene.
AATTAGTATGCTTACACAGCTGCAAATGAATGTAGTATATGCTCAGTGTTCTAAAACCGGGTCTACTAGGCTGTATACTTGGCCGTATACAAGTAACAGGTGCCCCTACCTGTTACCGTGTAATTGCCGGTTATACCGCATAATCGGGCCAATTATGCCGTATAATCACTACTAGGTGGGTGACCTGTCGAGTACTGGTTACCGATTTTTAGAACCTTGTATATGCTACAAGCCTACAAGGCACCTTGCATGATGGCCTTTCAAGCGTTGAACAGCTATTACCTAACTTGATGCTGCTTGACATTAAGCAACAGATGAGGAAGAAGCAAAGAAGCTTTAATTGGTGACTTTGATGAAGAGTAGGAAGAACTGGACTTATACCTGAGATCATCATCATCCTGCTAAAGAGCTCAAGTTTTGTCCTGGCAAGGAAAAGAAGCATCACAGGTAAGCTACTTTCACAGTTCCACTTGTACCACCAAAAGTACATCTGATGTGCCAAAGTAAAAAAGAATATCAATTGTGTTTTATATCTTGCAGGGTCTTCGTACATGTTATGTCTTGGCCGTTCCCACTTCCCAGTGCAGTATGCATATGGAAAGTCTAGCAGCCATCTGGGGGGCATAATTATGCCAGGAGCTTCCCCCAGCGCGATTGGATCTTCGCTGCAGATCAATAGAAGCAGAGACCTTTGGTATCGCAGATGCTATACATTCAGGAATAACATCATGCTTTAACACTGCCCAGTTTCTCTGAAAGAATCTGCCAGGTAAACCGTCCTGCTTAGGGGCCTTAAGTGGACCAATCTGAAAGGGCATTGCTGATTTCCTCTTCAGAGAGCTGCTTGCAAAAACTTCCATCGTATGTTCTACCTGGTGCGGCACTTGACGGGGGAGCGACAGCAGGATCGCGCGTTTTGTAAGATGCTGGGAAAAAAGGCCAAAACCTTCTGCTTCCAGCCTTCGACTGCCTCGCCGTTAACGCCCTTCAGTTTTTTTAAT
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
CDS sequence
ATGGCGTCGCTGGCGGCGGGGACGCCGCCGTTCCTGACGAAGACGTACGCGATGGTGGAGGACCCGAGCACCGACGACACCATCTCGTGGAACGACTCTGGCACGGCCTTCGTGGTGTGGCTCCCCGCCGAGTTCGCCCGCGACCTCCTCCCCAAGCACTTCAAGCACAGCAACTTCTCTTCCTTCGTTCGCCAGCTGAACACCTACGGATTTAAGAAGGTGGGGGCGGATAGGTGGGAGTTCGCCAACGACTGCTTCAGGAGGGGGGAGAGGCATCTGCTCGGAGGGATACAGAGGCGGAAGGGGTCTGGCGCCGGGGCGCCGGCGCCGACGGGGAGCATAACGACGGCGATACCGATCTCGTCCCCGCCGACGAGCTCCGGCGGGGAGCCCGCGGTGTCTTCGTCGCCGCCGCGCGGGGCCTCGGCGGCGGGGGTGAGCGGCGCGGTGGCCGAGCTGGAGGAGGAGAACGCGCGGCTGCGGCGCGAGAAGCTCGCGCGCGCGCGCCGCCTCTGCGACAGTGTGCGGCGCCTCGTGTCGCGGTACGACCACGGCGGGGAGGAGGACTGGGAGGGGGACGAGGGGCCCGGCGGCGGCGGGAAGCCGACGCTATTCGGCGTCACGATCGGGGGAAAGAGGTCGCGCGAGGATGGCGACGACGAGGAGGAAGACGGGGCCGAGGAGGACGGCGAGGACGAAGACGAAGACGAGGACGACGACGACGAGAGGCACGCGGCGCGGCGGGGGTCGGCGAGGGAGGGGAAGGCTAGGAGGACGGAGCTGTCGGATCTGGACGTGCTCGCGCTGTCCGTGCGGGCGGCGGCGGCGGCGAGGCCGGGTGGGGGCTCGCGTGATCGCAAGAACTCGTCGGCCTCGTAG
Copy to clipboard
BLAST search against this genome or other genomes in database  
Downstream 1000 bp region from PH01000000G3800 gene.
GACGAGACGGCACAAATATACGAAACAAGGATATATAGACGGTATAAAACATCATTGTATGAACTATTGTTTATAATAAATATTTTTTTCATGTTATAATTAAAAGATTGTAGGGTCTCATAGATACAAACTTAAGAAATAATTTAAAGTTATCTTTAGTCTTATATCTATATGATATGGATGGATATATAGATAAGAGTCGTCTATGCTATTGTAGATACTCTTGTATGCATTTTTTTTTTGAGATTTACTGTTGTTTTTGTGCGGGTGCGGGGAGGGTAATGAGCAATGAGATTGTCACTTTTCTTTGTTCTATAATACTAGTACTAGTAAGGCACTATTTTTCGTCTAAATACCGTTCACCAGCAGTCCAGCACGATAAAAGGTATCTGAGCAGGAAGTGTGGAGAATCAAGATTATTCGACGTTCAGCCGAGTAGCCGACATGTTCTTGCCATTTCTTTCTGAGGGCAGTAGCAAATTGGCAATGTACACAGAGTGGGCATTTGGCAATCACGATACCTATTTTCATCATATAAACTGCGCAGGATAGAGAGAGCCCACTGGGTTGAAACACCAGGCTACTCTACTCCAAGTTGTTTGTGTGGCGGACCCTCATCTGGGCCGGGCTCTGGCCTAGCACGCGCGCGAGCTCCAGCACCACCATCTCGAACAGGCTTCCCATCGGCAGCTTCGCTTGCGGCCGCGAGCTCCCCCGTACCATCCTCGTCGTCAGCCATGGTCTGCGCGGGGAGGTGGGCCACGACGTCCGCCTGGAGCCGCGGGATGTCCCCGTCCGGCCGCGCGGTGAGCAGCACAACGCGCGCGCCGGCGCCGCAGATGGCGTCGACGGTGGAGAACGCGCCCGGCCCAGCGGAGGCGACGAGGAGATCGCCGGCCGAGACTGGCGGCGCGGTGACGTCGCCGATGCAGTGCACAGGGAGGCCGATGTGCGCGAGGCGCATGCAGAGGGCGCGCATCATGAGGTCCTCGCGCCCAACG
Copy to clipboard
BLAST search against this genome or other genomes in database  
Need more than 1000 bp? Try sequence retrieval tool or view intergenic regions in GBrowse.
Scaffold PH01000000 Download
Protein sequence
Protein sequence
MASLAAGTPPFLTKTYAMVEDPSTDDTISWNDSGTAFVVWLPAEFARDLLPKHFKHSNFSSFVRQLNTYGFKKVGADRWEFANDCFRRGERHLLGGIQRRKGSGAGAPAPTGSITTAIPISSPPTSSGGEPAVSSSPPRGASAAGVSGAVAELEEENARLRREKLARARRLCDSVRRLVSRYDHGGEEDWEGDEGPGGGGKPTLFGVTIGGKRSREDGDDEEEDGAEEDGEDEDEDEDDDDERHAARRGSAREGKARRTELSDLDVLALSVRAAAAARPGGGSRDRKNSSAS
Copy to clipboard
BLAST search against this genome or other genomes in database  
 

* This site recommends the best viewd with 1024x768 in IE8 or above