MicroRNAs data of bamboo

MicroRNAs (miRNAs), a class of non-coding small endogenous RNAs with lengths of approximate 22 nucleotides, have been shown to regulate gene expression at the post-transcriptional levels by targeting mRNAs for degradation or by inhibiting protein translation. In additional, the putative target genes appeared to be involved in wide range of biological processes and most of them were classified as transcription factors, transporter and functional proteins.

There are 3 papers on microRNA of bamboo, including 2 papers based on next-generation sequencing and 1 paper based on genome predicted.

Experimental data

>1. Zhao, H., Chen, D., Peng, Z., Wang, L. and Gao, Z. (2013) Identification and Characterization of MicroRNAs in the Leaf of Ma Bamboo (Dendrocalamus latiflorus) by Deep Sequencing. PloS one, 8, e78755.

>2. He, C.Y., Cui, K., Zhang, J.G., Duan, A.G. and Zeng, Y.F. (2013) Next-generation sequencing-based mRNA and microRNA expression profiling analysis revealed pathways involved in the rapid growth of developing culms in Moso bamboo. BMC plant biology, 13, 119.

Predicted data

>3. Peng, Z., Lu, Y., Li, L., Zhao, Q., Feng, Q., Gao, Z., Lu, H., Hu, T., Yao, N., Liu, K. et al. (2013) The draft genome of the fast-growing non-timber forest species moso bamboo (Phyllostachys heterocycla). Nature genetics, 45, 456-461, 461e451-452.

miRNA Family Cadidata Name Sequences Length Precursor Position Target genes
miR156 phe-miR156a-1 ugugcucacucucuucuguca 21 PH01000043:666079..666164:+ PH01003057G0020;PH01001697G0180;PH01000190G1320;PH01000040G1590;
PH01003053G0120;PH01000162G0280;PH01000985G0240;PH01001990G0350
phe-miR156a-2 ugugcucacucucuucuguca 21 PH01000118:666463..666549:+
phe-miR156a-3 ugugcucacucucuucuguca 21 PH01002501:58974..58885:-
phe-miR156b gacagaagggagugagcaca 20 PH01000906:369381..369480:+ PH01000594G0440;PH01000969G0180;PH01000770G0270;PH01002789G0180;
PH01000150G0460;PH01000050G0170;PH01003178G0220;PH01002673G0070;
PH01000117G1390;PH01000002G1660;PH01003773G0220;PH01000548G0580;
PH01000145G0070;PH01000095G1560;PH01000164G0630;PH01000176G0670;
PH01002850G0100;PH01000419G0780;PH01002353G0030;PH01001262G0160
phe-miR156c-1 gcucacugcucuaucugucag 21 PH01000906:369648..369735:+ PH01000169G0700;PH01001308G0140
phe-miR156c-2 gcucacugcucuaucugucag 21 PH01001488:110643..110731:+
phe-miR156d ugacagaaagagaagugagc 20 PH01001164:270699..270610:- PH01000188G0820;PH01000113G1040;PH01000300G0800
phe-miR156e-1 ugacagaagagagugagcaca 21 PH01000586:12179..12261:+ PH01000594G0440;PH01000969G0180;PH01000770G0270;PH01002789G0180;
PH01000150G0460;PH01000050G0170;PH01003178G0220;PH01002673G0070;
PH01000117G1390;PH01000002G1660;PH01003773G0220;PH01000548G0580;
PH01000145G0070;PH01000095G1560;PH01000164G0630;PH01000176G0670;
PH01000450G0480;PH01004816G0090
phe-miR156e-2 ugacagaagagagugagcaca 21 PH01000780:82472..82559:+
phe-miR156e-3 ugacagaagagagugagcaca 21 PH01000906:369864..369949:+
phe-miR156e-4 ugacagaagagagugagcaca 21 PH01001039:11162..11247:+
phe-miR156e-5 ugacagaagagagugagcaca 21 PH01001488:110870..110951:+
phe-miR156e-6 ugacagaagagagugagcaca 21 PH01001488:110416..110512:+
phe-miR156f ugacaggaagacaagugagc 20 PH01007085:18688..18778:+ PH01000068G0320
miR160 phe-miR160a-1 ugccuggcucccugaaugccauc 23 PH01000290:466938..467024:+ PH01000845G0410;PH01002498G0280;PH01000305G0690;PH01002685G0120
phe-miR160a-2 ugccuggcucccugaaugccauc 23 PH01000323:659395..659481:+
phe-miR160b-1 ugccuggcucccuguaugcca 21 PH01000093:289932..290019:+ PH01000044G0540;PH01002498G0280;PH01000305G0690;PH01002685G0120;
PH01000845G0410;PH01000044G0540;PH01002197G0180
phe-miR160b-2 ugccuggcucccuguaugcca 21 PH01000331:384072..384162:+
phe-miR160b-3 ugccuggcucccuguaugcca 21 PH01000702:419962..420049:+
phe-miR160c-1 uggcauacagggagccaggca 21 PH01000264:503469..503557:+ PH01000704G0630;PH01000365G0370;PH01000040G0150
phe-miR160c-2 uggcauacagggagccaggca 21 PH01000483:447580..447667:+
phe-miR160c-3 uggcauacagggagccaggca 21 PH01001046:335258..335346:+
phe-miR160c-4 uggcauacagggagccaggca 21 PH01002185:168248..168335:+
miR164 phe-miR164a agcacgugcccugcuucucca 21 PH01000210:590918..591007:+ PH01006426G0020;PH01000331G0860
phe-miR164b uggagaagcagggcacgugcu 21 PH01000543:161242..161323:+ PH01000183G1320;PH01000110G0680;PH01001309G0120;PH01000093G0340;
PH01000483G1000;PH01000501G0450;PH01004795G0030
miR166 phe-miR166 ucggaccaggcuucauucccc 21 PH01000922:46428..46516:+ PH01001892G0010;PH01000305G0590;PH01000039G0640;PH01000996G0010;
PH01002498G0270;PH01000183G0940;PH01000056G0580
miR167 phe-miR167-1 ggaucaaugugaucccuuugga 22 PH01010914:1323..1448:+ PH01177270G0010;PH01002169G0400;PH01000177G0450;PH01002475G0070;
PH01000046G1660;PH01001473G0180;PH01001473G0230;PH01000591G0890
phe-miR167-2 ggaucaaugugaucccuuugga 22 PH01254050:33..158:+
miR168 phe-miR168a auucacuuggugcaaggcgggauc 24 PH01000585:406073..405971:- PH01000038G1530;PH01000115G1120;PH01000154G0110
phe-miR168b gaucccgccuugcaccaagugaau 24 PH01000280:263186..263288:+ N/A
miR169 phe-miR169a-1 aggcaagucauccuuggcua 20 PH01000117:250726..250855:+ PH01003970G0120
phe-miR169a-2 aggcaagucauccuuggcua 20 PH01000117:259000..259134:+
phe-miR169a-3 aggcaagucauccuuggcua 20 PH01001476:280681..280806:+
phe-miR169a-4 aggcaagucauccuuggcua 20 PH01002131:66421..66553:+
phe-miR169b-1 cagccaaggaugacuugccgg 21 PH01000224:320748..320862:+ PH01001863G0110
phe-miR169b-2 cagccaaggaugacuugccgg 21 PH01000450:474597..474730:+
phe-miR169b-3 cagccaaggaugacuugccgg 21 PH01003804:20343..20457:+
phe-miR169c-1 caggcaagucauccuuggcua 21 PH01000117:250726..250855:+ PH01000558G0230;PH01000718G0330;PH01002440G0320;PH01027796G0010;
PH01001563G0300
phe-miR169c-2 caggcaagucauccuuggcua 21 PH01000117:259000..259134:+
phe-miR169c-3 caggcaagucauccuuggcua 21 PH01001476:280681..280806:+
phe-miR169c-4 caggcaagucauccuuggcua 21 PH01002131:66421..66553:+
phe-miR169d ggcaagucuguccuuggcuaca 22 PH01003459:60441..60556:+ N/A
miR171 phe-miR171a agugauauugguccggcucac 21 PH01000211:698809..698913:+ PH01003187G0090
phe-miR171b cgugauauuggcacggcucaa 21 PH01001939:153229..153329:+ PH01002297G0180
phe-miR171c gaggugagccgagccaauauc 21 PH01004540:19845..19950:+ N/A
phe-miR171d gugagccgaaccaauaucacu 21 PH01000200:274184..274287:+ PH01003025G0200
phe-miR171e-1 ugauugagccgcgccaauaucu 22 PH01000169:665445..665544:+ PH01001692G0030;PH01002325G0040;PH01000386G0490;PH01001067G0070
phe-miR171e-2 ugauugagccgcgccaauaucu 22 PH01000366:761876..761975:+
phe-miR171f-1 ugauugagccgugccaauauc 21 PH01000390:348988..349106:+ N/A
phe-miR171f-2 ugauugagccgugccaauauc 21 PH01001439:341521..341642:+
phe-miR171f-3 ugauugagccgugccaauauc 21 PH01001475:187829..187929:+
phe-miR171f-4 ugauugagccgugccaauauc 21 PH01003493:107937..108059:+
phe-miR171f-5 ugauugagccgugccaauauc 21 PH01004538:30446..30545:+
phe-miR171f-6 ugauugagccgugccaauauc 21 PH01003786:44053..44153:+
phe-miR171g-1 uugagccgugccaauaucacg 21 PH01001475:187829..187929:+ PH01001692G0030;PH01000417G0950;PH01002641G0230
phe-miR171g-2 uugagccgugccaauaucacg 21 PH01003786:44053..44153:+
phe-miR171g-3 uugagccgugccaauaucacg 21 PH01004538:30446..30545:+
miR172 phe-miR172a-1 augcagcaucaucaagauucuca 23 PH01000466:543398..543508:+ PH01001057G0450;PH01003011G0180;PH01001844G0390;PH01001683G0200;
PH01000750G0690;PH01000753G0380
phe-miR172a-2 augcagcaucaucaagauucuca 23 PH01004738:53685..53795:+
phe-miR172b ugagaaucuugaugaugcugcau 23 PH01000021:872620..872730:+ PH01001762G0240;PH01000169G1430;PH01000948G0320;PH01000223G1130;
PH01000464G0470;PH01002393G0210
miR319 phe-miR319-1 agcugccgacucauccauuca 21 PH01000182:85539..85691:+ PH01000099G1290;PH01000035G2440
phe-miR319-2 agcugccgacucauccauuca 21 PH01000568:358009..358161:+
miR393 phe-miR393 ggaucaaugcgaucccuuugga 22 PH01000015:1104008..1104133:+ PH01002169G0400;PH01000591G0890
miR395 phe-miR395a agagucccccaaacacuucac 21 PH01000383:416223..416332:+ PH01001750G0010;PH01037242G0010;PH01001160G0010;PH01000281G1170;
PH01003111G0150
phe-miR395b gaguucccccaaacacuucac 21 PH01003129:118716..118801:+
phe-miR395c-1 gugaaguguuugggggaacuc 21 PH01000055:1149133..1149218:+ PH01001118G0090;PH01005417G0030;PH01001857G0210;PH01003119G0210
phe-miR395c-2 gugaaguguuugggggaacuc 21 PH01000055:1149281..1149366:+
phe-miR395c-3 gugaaguguuugggggaacuc 21 PH01000055:1149427..1149512:+
phe-miR395c-4 gugaaguguuugggggaacuc 21 PH01000055:1149128..1149371:+
phe-miR395d guuccuugcaagcacuucacau 22 PH01001283:8929..9041:+ PH01000428G0740;PH01001410G0190
phe-miR395e guucuccucaaaccacuccagu 22 PH01000055:1148893..1149025:+ PH01002242G0280;PH01002550G0300
miR399 phe-miR399a cagggcaacucuccuuuggca 21 PH01000000:1666476..1666574:+ N/A
phe-miR399b cggggcaaauuuccuuuggc 20 PH01000429:29334..29437:+ PH01002416G0140;PH01000725G0050
phe-miR399c ggggaaaaauuccuuuggc 19 PH01000814:420386..420283:- N/A
phe-miR399d ugccaaaggagaauugcccug 21 PH01004613:73281..73392:+ N/A
phe-miR399e ugccaaaggagagcugcccug 21 PH01000584:331553..331670:+ PH01002494G0310;PH01008027G0010
miR535 phe-miR535a-1 gcgugcucucucucguuguca 21 PH01001265:184327..184432:+ PH01003320G0120;PH01000433G0800;PH01000680G0660;PH01000788G0630;
PH01002190G0080;PH01000564G0170
phe-miR535a-2 gcgugcucucucucguuguca 21 PH01001265:381146..381250:+
phe-miR535a-3 gcgugcucucucucguuguca 21 PH01004182:79704..79809:+
phe-miR535b ugacaacgagagagagcacgc 21 PH01001768:289094..289199:+ N/A
miR4414 phe-miR4414a gugaaugaagcgggagguaa 20 PH01000257:162116..162196:+ PH01000123G1430
phe-miR4414c uuaccucccgcuucauucac 20 PH01001252:136587..136507:- PH01005083G0060;PH01000793G0170;PH01000306G0790;PH01000988G0460
miR5750 phe-miR5750a-1 aagagagauauauaagauuug 21 PH01000378:744714..744990:+ PH01000367G0730;PH01000218G1040;PH01001994G0160;PH01001826G0050
phe-miR5750a-2 aagagagauauauaagauuug 21 PH01000535:440139..440270:+
phe-miR5750b-1 caaaucuuauauaucucucuu 21 PH01000753:535410..535686:+ PH01002128G0250;PH01000223G0930;PH01000139G0960
phe-miR5750b-2 caaaucuuauauaucucucuu 21 PH01003487:141110..141386:+

# This site recommends the best viewd with 1024x768 in IE8 or above